MilliporeSigma
All Photos(1)

Documents

EHU009271

Sigma-Aldrich

MISSION® esiRNA

targeting human PPM1D

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGTCAGAGCTGTGGAGGTGACACAGGACCATAAGCCAGAACTTCCCAAGGAAAGAGAACGAATCGAAGGACTTGGTGGGAGTGTAATGAACAAGTCTGGGGTGAATCGTGTAGTTTGGAAACGACCTCGACTCACTCACAATGGACCTGTTAGAAGGAGCACAGTTATTGACCAGATTCCTTTTCTGGCAGTAGCAAGAGCACTTGGTGATTTGTGGAGCTATGATTTCTTCAGTGGTGAATTTGTGGTGTCACCTGAACCAGACACAAGTGTCCACACTCTTGACCCTCAGAAGCACAAGTATATTATATTGGGGAGTGATGGACTTTGGAATATGATTCCACCACAAGATGCCATCTCAATGTGCCAGGACCAAGAGGAGAAAAAATACCTGATGGGTGAGCATGGACAATCTTGTGCCAAAATGCTTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU030791EHU044581EHU082911
MISSION® esiRNA targeting human PPM1D

EHU009271

MISSION® esiRNA

MISSION® esiRNA targeting human PPFIBP2

EHU030791

MISSION® esiRNA

MISSION® esiRNA targeting human PPM1E

EHU044581

MISSION® esiRNA

MISSION® esiRNA targeting human PPM1J

EHU082911

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | human accession no.

ENSG00000170836

Ensembl | human accession no.

ENSG00000166387

Ensembl | human accession no.

ENSG00000175175

Ensembl | human accession no.

ENSG00000155367

esiRNA cDNA target sequence

TTGTCAGAGCTGTGGAGGTGACACAGGACCATAAGCCAGAACTTCCCAAGGAAAGAGAACGAATCGAAGGACTTGGTGGGAGTGTAATGAACAAGTCTGGGGTGAATCGTGTAGTTTGGAAACGACCTCGACTCACTCACAATGGACCTGTTAGAAGGAGCACAGTTATTGACCAGATTCCTTTTCTGGCAGTAGCAAGAGCACTTGGTGATTTGTGGAGCTATGATTTCTTCAGTGGTGAATTTGTGGTGTCACCTGAACCAGACACAAGTGTCCACACTCTTGACCCTCAGAAGCACAAGTATATTATATTGGGGAGTGATGGACTTTGGAATATGATTCCACCACAAGATGCCATCTCAATGTGCCAGGACCAAGAGGAGAAAAAATACCTGATGGGTGAGCATGGACAATCTTGTGCCAAAATGCTTGTG

esiRNA cDNA target sequence

CAGCAAGTGGAACGCTACAAATAAGGACCCTGAAGAATTATTTAAACAAGAGATGCCTCCAAGATGTAGCTCTCCTACAGTGGGGCCACCTCCATTGCCACAGAAATCACTGGAAACCAGGGCTCAGAAAAAGCTCTCTTGTAGTCTAGAAGACTTGAGAAGTGAATCTGTGGATAAGTGTATGGATGGGAACCAGCCCTTCCCGGTGTTAGAACCCAAGGACAGCCCTTTCTTGGCGGAGCACAAATATCCCACTTTACCTGGGAAGCTTTCAGGAGCCACGCCCAATGGAGAGGCTGCCAAATCTCCTCCCACCATCTGCCAGCCTGACGCCACGGGGAGCAGCCTGCTGAGGCTGAGAGACACAGAAAGTGGCTGGGACGACACTGCTGTGGTCAATGACCTCTCATCCACATCATCGGGCACTGAATCAGGTCCTCAGTCTCCTCTGACACCAGATGGTAAACGGAATCCCAAAG

esiRNA cDNA target sequence

GGACCACAGGAGTGGTGACTTTCATCAGAGGCAACATGCTACATGTGGCCTGGGTGGGTGATTCCCAGGTTATGCTTGTGAGAAAGGGCCAAGCTGTTGAACTAATGAAGCCACACAAACCAGACAGAGAGGATGAAAAGCAGAGAATTGAGGCCCTTGGAGGTTGCGTAGTCTGGTTTGGTGCCTGGAGGGTGAATGGAAGTCTGTCGGTTTCCAGAGCTATTGGAGATGCTGAACATAAGCCATATATCTGTGGGGATGCAGATTCTGCCTCCACTGTTCTGGATGGGACCGAAGACTACCTCATTCTGGCCTGTGATGGCTTCTATGACACCGTGAACCCTGATGAGGCAGTGAAAGTTGTGTCCGACCACCTGAAAGAGAATAATGGAGACAGCAGCATGG

esiRNA cDNA target sequence

TTTCTCTCCTGCTTCCCTGAGGTACGAGTGTATGACCTGACACAATATGAGCACTGCCCAGATGATGTGCTAGTCCTGGGAACAGATGGCCTGTGGGATGTCACTACTGACTGTGAGGTAGCTGCCACTGTGGACAGGGTGCTGTCGGCCTATGAGCCTAATGACCACAGCAGGTATACAGCTCTGGCCCAAGCTCTGGTCCTGGGGGCCCGGGGTACCCCCCGAGACCGTGGCTGGCGTCTCCCCAACAACAAGCTGGGTTCCGGGGATGACATCTCTGTCTTCGTCATCCCCCTGGGAGGGCCAGGCAGTTACTCCTGAGGGGCTGAACACCATCCCTCCCACTAGCCTCTCCATACTTACTCCTCTCACAGCCCAAATTCTGAAGTTGTCTCCCTGACCC

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Chen Chen et al.
Journal of Cancer, 11(11), 3216-3224 (2020-04-02)
Accumulated studies showed that numerous microRNAs (miRNAs) were aberrantly expressed in human intrahepatic cholangiocarcinoma (ICC) and contributed to the tumorigenic processes. However, whether miR-129-2-3p is implicated in the ICC initiation and progression is still limited. Here, the results revealed that
Dong-Seok Park et al.
EMBO reports, 21(5), e48693-e48693 (2020-02-28)
The tumor suppressor Smad4, a key mediator of the TGF-β/BMP pathways, is essential for development and tissue homeostasis. Phosphorylation of Smad4 in its linker region catalyzed by the mitogen-activated protein kinase (MAPK) plays a pivotal role in regulating its transcriptional
Zhong-Wu Lu et al.
Oncology reports, 43(3), 783-794 (2020-01-11)
Endeavors towards identifying key molecular markers for early diagnosis and treatment are driving the clinical study of papillary thyroid carcinoma (PTC). Recent studies have indicated that protein phosphatase, Mg2+/Mn2+ dependent, 1D (PPM1D) exerts an oncogenic function by increasing cell proliferation, migration
Jin Ju Park et al.
Technology in cancer research & treatment, 19, 1533033820964425-1533033820964425 (2020-10-24)
Several techniques have been employed for deletion of the NKX3.1 gene, resulting in developmental defects of the prostate, including alterations in ductal branching morphogenesis and prostatic secretions as well as epithelial hyperplasia and dysplasia. To investigate whether the CRISPR/Cas9-mediated technique
Tian-Shu Peng et al.
Experimental and therapeutic medicine, 8(2), 430-434 (2014-07-11)
Protein phosphatase, Mg

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service