Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU035581

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTGACTCTCTGGGCTGTGATCGATTGGGCTGCTTTAACCTCAGCATCCGAGGGCATGGGGAATGCGTTGAATATGTCAAGAGCTTCAATATCCCTCTACTCGTGCTGGGTGGTGGTGGTTATACTGTCCGAAATGTTGCCCGCTGCTGGACATATGAGACATCGCTGCTGGTAGAAGAGGCCATTAGTGAGGAGCTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGACTTCACACTTCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACCTGAAGATGCTGAACCATGCACCTAGTGTCCAGATTCATGACGTGCCTGCAGACCTCCTGACCTATGACAGGACTGATGAGGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jingzhu Zhang et al.
Frontiers in molecular neuroscience, 10, 395-395 (2017-12-15)
The impairment of amyloid-β (Aβ) clearance in the brain plays a causative role in Alzheimer's disease (AD). Polarity distribution of aquaporin-4 (AQP4) is important to remove Aβ from brain. AQP4 polarity can be influenced by the ratio of two AQP4
Mohammed Ghiboub et al.
Frontiers in immunology, 11, 550769-550769 (2020-10-31)
Histone deacetylases (HDACs) are a group of enzymes that control histone deacetylation and bear potential to direct expression of large gene sets. We determined the effect of HDAC inhibitors (HDACi) on human monocytes and macrophages, with respect to their polarization
A Krell et al.
Neuropathology and applied neurobiology, 45(5), 441-458 (2018-12-15)
Aberrant expression of microRNAs (miRNAs) is frequent in various cancers including gliomas. We aimed to characterize the role of miR-16-5p as a candidate tumour suppressor miRNA in gliomas. Real-time PCR-based approaches were used for miRNA and mRNA expression profiling of
Yuyao Yin et al.
Cell death & disease, 8(6), e2856-e2856 (2017-06-02)
Histone deacetylase 3 (HDAC3) has an oncogenic role in apoptosis and contributes to the proliferation of cancer cells. MI192 is a novel HDAC3-specific inhibitor that displays antitumor activity in many cancer cell lines. However, the role of HDAC3 and the
Qin Xu et al.
Inflammation (2018-05-08)
Extracellular high mobility group box 1 (HMGB1) is a lethal pro-inflammatory mediator in endotoxin shock. Hyperacetylation of HMGB1, regulated by histone acetyltransferases (HATs) and histone deacetylases (HDACs), changes its subcellular localization and secretion to the extracellular matrix. Paeonol (2'-hydroxy-4'-methoxyacetophenone), one

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service