MilliporeSigma
All Photos(1)

Documents

EHU041401

Sigma-Aldrich

MISSION® esiRNA

targeting human TERF2IP

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGCTGCCATTAAGATCATTCGGCAGTTAATGGAGAAGTTTAACTTGGATCTATCAACAGTTACACAGGCCTTCCTAAAAAATAGTGGTGAGCTGGAGGCTACTTCCGCCTTCTTAGCGTCTGGTCAGAGAGCTGATGGATATCCCATTTGGTCCCGACAAGATGACATAGATTTGCAAAAAGATGATGAGGATACCAGAGAGGCATTGGTCAAAAAATTTGGTGCTCAGAATGTAGCTCGGAGGATTGAATTTCGAAAGAAATAATTGGCAAGATAATGAGAAAAGAAAAAAGTCATGGTAGGTGAGGTGGTTAAAAAAAATTGTGACCAATGAACTTTAGAGAGTTCTTGCATTGGAACTGGCACTTATTTTCTGACCATCGCTGCTGTTGCTCTGTGAGTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU042991EHU058581EHU009641
MISSION® esiRNA targeting human TERF2IP

EHU041401

MISSION® esiRNA

MISSION® esiRNA targeting human TERF2

EHU042991

MISSION® esiRNA

MISSION® esiRNA targeting human EIF3L

EHU058581

MISSION® esiRNA

MISSION® esiRNA targeting human EQTN

EHU009641

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | human accession no.

ENSG00000166848

Ensembl | human accession no.

ENSG00000132604

Ensembl | human accession no.

ENSG00000100129

Ensembl | human accession no.

ENSG00000120160

Gene Information

human ... TERF2IP(54386), TERF2IP(54386)

Gene Information

human ... TERF2(7014), TERF2(7014)

Gene Information

human ... EIF3L(51386), EIF3EIP(51386)

Gene Information

human ... EQTN(54586), C9orf11(54586)

NCBI accession no.

NM_018975

NCBI accession no.

NM_005652

NCBI accession no.

NM_016091

NCBI accession no.

NM_020641

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service