MilliporeSigma
All Photos(1)

Documents

EHU093641

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFB1I1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGATGAAATCATGTCTCAGTTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGATAAGAAAAGACCCAGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACTCTGGAGCTGGATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGGCCAACTCAGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAGGGCAGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGCCAAAGGCCTCTGTGGCTCCTGCAATAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU016801EHU130921EHU026081
MISSION® esiRNA targeting human TGFB1I1

EHU093641

MISSION® esiRNA

MISSION® esiRNA targeting human TGFB1

EHU016801

MISSION® esiRNA

MISSION® esiRNA targeting human TGFBI

EHU130921

MISSION® esiRNA

MISSION® esiRNA targeting human TGM1

EHU026081

MISSION® esiRNA

Gene Information

human ... TGFB1I1(7041), TGFB1I1(7041)

Gene Information

human ... TGFB1(7040), TGFB1(7040)

Gene Information

human ... TGFBI(7045), TGFBI(7045)

Gene Information

human ... TGM1(7051), TGM1(7051)

esiRNA cDNA target sequence

GCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGATGAAATCATGTCTCAGTTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGATAAGAAAAGACCCAGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACTCTGGAGCTGGATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGGCCAACTCAGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAGGGCAGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGCCAAAGGCCTCTGTGGCTCCTGCAATAA

esiRNA cDNA target sequence

GAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTC

esiRNA cDNA target sequence

ATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCA

esiRNA cDNA target sequence

CCCCAAGAGACTAGCAGTGGCATCTTCTGCTGCGGCCCCTGCTCTGTGGAGTCCATCAAGAATGGCCTGGTCTACATGAAGTACGACACGCCTTTCATTTTTGCTGAGGTGAATAGTGACAAGGTGTACTGGCAGCGGCAGGATGATGGCAGCTTCAAGATTGTTTATGTGGAGGAGAAGGCCATCGGCACACTCATTGTCACAAAGGCCATCAGCTCCAACATGCGGGAGGACATCACCTACCTCTATAAGCACCCAGAAGGCTCAGACGCAGAGCGGAAGGCAGTAGAGACAGCAGCAGCCCACGGCAGCAAACCCAATGTGTATGCCAACCGGGGCTCAGCGGAGGATGTGGCCATGCAGGTGGAGGCACAGGACGCGGTGATGGGGCAGGATCTGATGGTCTCTGTGATGCTGA

Ensembl | human accession no.

ENSG00000140682

Ensembl | human accession no.

ENSG00000105329

Ensembl | human accession no.

ENSG00000120708

Ensembl | human accession no.

ENSG00000092295

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NM_001042454

NCBI accession no.

NM_000660

NCBI accession no.

NM_000358

NCBI accession no.

NM_000359

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Razan Sheta et al.
Oncotarget, 8(47), 82506-82530 (2017-11-16)
The molecular basis of epithelial ovarian cancer (EOC) dissemination is still poorly understood. We have previously identified the hydrogen peroxide-inducible clone-5 (Hic-5) gene as hypomethylated in high-grade (HG) serous EOC tumors, compared to normal ovarian tissues. Hic-5 is a focal
J Paul et al.
Mucosal immunology, 11(2), 427-436 (2017-06-15)
Intestinal fibrosis is a major complication in inflammatory bowel diseases, but the regulatory mechanism that inhibits fibrosis remains unclear. Here we demonstrate that Itch-/-myofibroblasts express increased amounts of profibrotic collagen type I and α-SMA in response to IL-17. Mechanistically, we
Sonsoles Piera-Velazquez et al.
Rheumatology (Oxford, England), 59(10), 3092-3098 (2020-05-23)
SSc is a systemic fibrotic disease affecting skin, numerous internal organs and the microvasculature. The molecular pathogenesis of SSc tissue fibrosis has not been fully elucidated, although TGF-β1 plays a crucial role. The Hic-5 protein encoded by the TGF-β1-inducible HIC-5
Rishel B Vohnoutka et al.
Molecular biology of the cell, 30(25), 3037-3056 (2019-10-24)
Focal adhesion (FA)-stimulated reorganization of the F-actin cytoskeleton regulates cellular size, shape, and mechanical properties. However, FA cross-talk with the intermediate filament cytoskeleton is poorly understood. Genetic ablation of the FA-associated scaffold protein Hic-5 in mouse cancer-associated fibroblasts (CAFs) promoted

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service