MilliporeSigma
All Photos(1)

Documents

EHU094591

Sigma-Aldrich

MISSION® esiRNA

targeting human MYB

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCAGTAGAGCTTGGACAGAAAGAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTTTTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCCTGTGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Yue Wang et al.
Cancer letters, 385, 234-242 (2016-10-25)
The oncoprotein Yes-associated protein (YAP) in Hippo pathway plays crucial roles in the development of cancer. However, the mechanism of YAP regulation in cancer remains poorly understood. Here, we supposed that the oncoprotein hepatitis B X-interacting protein (HBXIP) might be
Tian Lan et al.
Cancer research, 79(13), 3220-3234 (2019-05-19)
Understanding the roles of noncoding RNAs (ncRNA) in tumorigenesis and metastasis would establish novel avenues to identify diagnostic and therapeutic targets. Here, we aimed to identify hepatocellular carcinoma (HCC)-specific ncRNA and to investigate their roles in hepatocarcinogenesis and metastasis. RNA-seq
Neil Rajan et al.
The Journal of pathology, 239(2), 197-205 (2016-03-13)
Cutaneous cylindroma is an adnexal tumour with apocrine differentiation. A predisposition to multiple cylindromas is seen in patients with Brooke-Spiegler syndrome, who carry germline mutations in the tumour suppressor gene CYLD. Previous studies of inherited cylindromas have highlighted the frequent
Sapana Jalnapurkar et al.
Stem cell research & therapy, 7(1), 171-171 (2016-11-24)
The success of hematopoietic stem cell (HSC) transplantation is dependent on the quality of the donor HSCs. Some sources of HSCs display reduced engraftment efficiency either because of inadequate number (e.g., fetal liver and cord blood), or age-related dysfunction (e.g.
Xuefeng Li et al.
Nature microbiology, 1(10), 16132-16132 (2016-09-28)
MicroRNAs (miRNAs) play critical roles in various biological processes, including cell proliferation, development and host defence. However, the molecular mechanism for miRNAs in regulating bacterial-induced inflammation remains largely unclear. Here, we report that miR-301b augments pro-inflammatory response during pulmonary infection

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service