MilliporeSigma
All Photos(1)

Documents

EHU134591

Sigma-Aldrich

MISSION® esiRNA

targeting human PDE4B

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGAAAGAGACCTCCTAAAGACATTCAGAATCTCATCTGACACATTTATAACCTACATGATGACTTTAGAAGACCATTACCATTCTGACGTGGCATATCACAACAGCCTGCACGCTGCTGATGTAGCCCAGTCGACCCATGTTCTCCTTTCTACACCAGCATTAGACGCTGTCTTCACAGATTTGGAGATCCTGGCTGCCATTTTTGCAGCTGCCATCCATGACGTTGATCATCCTGGAGTCTCCAATCAGTTTCTCATCAACACAAATTCAGAACTTGCTTTGATGTATAATGATGAATCTGTGTTGGAAAATCATCACCTTGCTGTGGGTTTCAAACTGCTGCAAGAAGAACACTGTGACATCTTCATGAATCTCACCAAGAAGCAGCGTCAGACAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU088881EHU060201EHU141671
MISSION® esiRNA targeting human PDE4B

EHU134591

MISSION® esiRNA

MISSION® esiRNA targeting human PDE4A

EHU088881

MISSION® esiRNA

MISSION® esiRNA targeting human PDE4C

EHU060201

MISSION® esiRNA

MISSION® esiRNA targeting human PDE4A (3)

EHU141671

MISSION® esiRNA

Gene Information

human ... PDE4B(5142), PDE4B(5142)

Gene Information

human ... PDE4A(5141), PDE4A(5141)

Gene Information

human ... PDE4C(5143), PDE4C(5143)

Gene Information

human ... PDE4A(5141), PDE4A(5141)

Ensembl | human accession no.

ENSG00000184588

Ensembl | human accession no.

ENSG00000065989

Ensembl | human accession no.

ENSG00000105650

Ensembl | human accession no.

ENSG00000065989

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NM_001037339

NCBI accession no.

NM_006202

NCBI accession no.

NM_000923

NCBI accession no.

NM_001111307

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Jiao Xiao et al.
Cellular and molecular neurobiology, 40(3), 421-435 (2019-10-30)
Tumor necrosis factor-α (TNF-α) is a critical pro-inflammatory cytokine regulating neuroinflammation. At high concentrations, it is toxic to neurons, and such damage is positively correlated with acute and chronic neurological diseases. Our previous studies showed that inhibition of phosphodiesterase 4
Xue-Qi Liu et al.
Biochemical pharmacology, 180, 114132-114132 (2020-07-06)
Acute kidney injury (AKI), characterized by a rapid decline in renal function, is triggered by an acute inflammatory response that leads to kidney damage. An effective treatment for AKI is lacking. Using in vitro and in vivo AKI models, our
Dan Li et al.
International immunopharmacology, 90, 107176-107176 (2020-11-28)
Roflupram (ROF) is a novel phosphodiesterase 4 inhibitor. We previously found that ROF suppressed the production of pro-inflammatory factors in microglial cells; however, the underlying mechanisms are largely unknown. The present study aimed to elucidate the underlying molecular mechanisms of
Ming-Yu Chen et al.
Bioengineered, 12(1), 708-719 (2021-02-02)
Reportedly, long non-coding RNA (lncRNA) are crucial modulators in neurodegenerative diseases. Herein, we investigated the role of lncRNA nuclear enriched abundant transcript 1 (NEAT1) in Parkinson's disease (PD). In-vitro PD model was established based on SH-SY5Y cells treated with 1-methyl-4-phenylpyridinium
Jiahong Zhong et al.
Free radical biology & medicine, 135, 87-101 (2019-03-01)
The etiology of Parkinson's disease (PD) is generally not well understood, but it is believed to involve excessive oxidative insult. Hence, identifying therapeutic targets and compounds that exhibit protective effects against oxidative damage is a reasonable strategy to slow down

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service