Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU144451

Sigma-Aldrich

MISSION® esiRNA

targeting human NUPR1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGAGAGGCAGGGAAGACAAGCCAGGCACGATGGCCACCTTCCCACCAGCAACCAGCGCCCCCCAGCAGCCCCCAGGCCCGGAGGACGAGGACTCCAGCCTGGATGAATCTGACCTCTATAGCCTGGCCCATTCCTACCTCGGAGGTGGAGGCCGGAAAGGTCGCACCAAGAGAGAAGCTGCTGCCAACACCAACCGCCCCAGCCCTGGCGGGCACGAGAGGAAACTGGTGACCAAGCTGCAGAATTCAGAGAGGAAGAAGCGAGGGGCACGGCGCTGAGACAGAGCTGGAGATGAGGCCAGACCATGGACACTACACCCAGCAATAGAGACGGGACTGCGGAGGAAGGAGGACCCAGGACAGGATCCAGGCCGGCTTGCCACACCCCCCACCCCTAGGACTTATTCCCGCTGACTGAGTCTCTGAGGGGCTACCAGGAAAGCGCCTCCAACCCTAGCAAAAGTGCAAGATGGGGAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ki-Sun Kim et al.
Anatomy & cell biology, 45(1), 17-25 (2012-04-27)
Nuclear protein-1 (NUPR1) is a small nuclear protein that is responsive to various stress stimuli. Although NUPR1 has been associated with cancer development, its expression and roles in cholangiocarcinoma have not yet been described. In the present study, we found
Patricia M Schnepp et al.
Molecular cancer research : MCR, 18(9), 1290-1301 (2020-06-10)
The majority of patients with prostate cancer treated with docetaxel develop resistance to it. To better understand the mechanism behind the acquisition of resistance, we conducted single-cell RNA-sequencing (scRNA-seq) of docetaxel-sensitive and -resistant variants of DU145 and PC3 prostate cancer
Anthony Murphy et al.
Oncology reports, 45(4) (2021-03-03)
Nickel (Ni) is carcinogenic to humans, and causes cancers of the lung, nasal cavity, and paranasal sinuses. The primary mechanisms of Ni‑mediated carcinogenesis involve the epigenetic reprogramming of cells and the ability for Ni to mimic hypoxia. However, the exact
Yanchao Mu et al.
Autophagy, 14(4), 654-670 (2017-11-14)
In the advanced stages of cancer, autophagy is thought to promote tumor progression through its ability to mitigate various cellular stresses. However, the details of how autophagy is homeostatically regulated in such tumors are unknown. Here, we report that NUPR1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service