MilliporeSigma
All Photos(1)

Documents

EMU002331

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Zdhhc2

Sign Into View Organizational & Contract Pricing

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTCAGCTTGGGTTTCAGTAAAAACATGAGACAAGTGTTTGGTGATGAGAAGAAATACTGGCTGTTACCAGTATTTTCAAGTCAAGGTGATGGCTGTTCCTTTCCAACTTGCCTTGTTAACCAGGATCCTGAACAACCTTCTACTCCTGCGGGACTAAATTCAACAGTGAAAAATCCTGAAAACCACCAGTTTCCTGCAAAGCCTCTGAGAGAGTCCCAGAGCCATCTCCTTAAGGATTCTCAGACCTGGACAGAGAGCAGCGCAAACCCTGGGAAGGGCAAAGCCGGTATGAGCAACCCTGCATTAACTATGGAGAACGAGACTTAGTTCTACAATCAAAATAAAACCACTCTTGTAAAGTACCAGTGCTGTGGAGGAATGGAACAACCTTCCGATTGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU033421EMU025781EMU084861
MISSION® esiRNA targeting mouse Zdhhc2

EMU002331

MISSION® esiRNA

MISSION® esiRNA targeting mouse Zdhhc1

EMU033421

MISSION® esiRNA

MISSION® esiRNA targeting mouse Zdhhc3

EMU025781

MISSION® esiRNA

MISSION® esiRNA targeting mouse Zdhhc8

EMU084861

MISSION® esiRNA

Ensembl | mouse accession no.

ENSMUSG00000039470

Ensembl | mouse accession no.

ENSMUSG00000039199

Ensembl | mouse accession no.

ENSMUSG00000025786

Ensembl | mouse accession no.

ENSMUSG00000060166

Gene Information

mouse ... ZDHHC2(70546), Zdhhc2(70546)

Gene Information

mouse ... ZDHHC1(70796), Zdhhc1(70796)

Gene Information

mouse ... ZDHHC3(69035), Zdhhc3(69035)

Gene Information

mouse ... ZDHHC8(27801), Zdhhc8(27801)

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

NCBI accession no.

NM_178395

NCBI accession no.

NM_175160

NCBI accession no.

NM_026917

NCBI accession no.

NM_172151

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Yuan-Xue Jiang et al.
International journal of clinical and experimental medicine, 8(6), 8472-8484 (2015-08-27)
Overexpression of miR-155 in nasopharygeal carcinoma (NPC) is partly driven by Epstein-Bar virus infection. However the role of miR-155 in NPC oncogenesis is unclear. This study showed that miR-155 inhibitor could inhibit the cell migration in NPC cell lines. ZDHHC2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service