MilliporeSigma
All Photos(1)

Documents

EMU071921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU001941EMU085011EMU051181
MISSION® esiRNA targeting mouse Stat1

EMU071921

MISSION® esiRNA

MISSION® esiRNA targeting mouse Stat2

EMU001941

MISSION® esiRNA

MISSION® esiRNA targeting mouse Stat6

EMU085011

MISSION® esiRNA

MISSION® esiRNA targeting mouse Stc2

EMU051181

MISSION® esiRNA

esiRNA cDNA target sequence

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

esiRNA cDNA target sequence

GAATGCCCAAGTCATGGAGTTACTTCAGCGTCTGCTCCAAAGGTCCTTTGTAGTAGAAACCCAGCCCTGCATGCCCCAGACTCTCCACCGACCCCTCATCCTGAAGACTGGGAACAAGTTCACCGTCCGAACAAGACTTCTGGTGAGACTCCAGGAAGGCAGCGAATCACTCAAAGCAGAAGTCTCTGTCGACAGGAATTCAGACTTACCAGGCTTCCGGAAGTTCAACATTCTGACCTCAAACCAAAAAACCTTGACCCCGGAGGAGGGCCAGAGACAGGGCTTAATTTGGGACTTCGGCTTCTTGACTCTGGTGGAGCAACGCGCTGTGGGTGCAGGAAAGGGCAACAAGGGGCCGCTGGCAGTGACAGAGGAGTTACATGTCATCAGCTTCGTGGTTGAG

esiRNA cDNA target sequence

ATGGGACAATGCCTTCTCTGAGATGGACCGAGTGCCCTTTGTGGTGGGTGAGCGAGTGCCCTGGGAGAAGATGTGTGAAACCCTAAACCTCAAGTTTATGGTTGAGGTGGGGACCAGCCGGGGACTGCTTCCAGAGCACTTCCTGTTCCTCGCCCAGAAGATCTTCAACGACAACAGCCTCAGTGTGGAGGCCTTTCAGCACCGCTGTGTGTCCTGGTCACAGTTCAATAAGGAGATCCTGCTGGGCCGAGGCTTCACATTTTGGCAGTGGTTTGATGGTGTCCTGGACCTCACCAAACGCTGTCTCCGGAGCTACTGGTCAGATCGGCTGATCATTGGCTTTATTAGTAAGCAATATGTCACTAGCCTTCTCCTCAATGAGCCAGATGGGACCTTCCTCCTCCGCTTTAGCGACTCTGAGATCGGGGGCATCACCATTGCACACGTCATCCGGGGTCAGGATGGCTCCTCACAGATAGAGAACATCCAGCCATTTTCTGC

esiRNA cDNA target sequence

CCAGCACTGTTTGGTCAATGCCGGGGACGTGGGCTGTGGTGTGTTTGAGTGTTTCGAGAACAACTCTTGTGAAATCCAGGGTTTACATGGGATTTGCATGACGTTTCTGCACAACGCTGGAAAATTCGATGCCCAGGGAAAGTCATTCATCAAGGATGCCCTGAGGTGCAAGGCCCATGCCCTGCGTCATAAATTTGGCTGCATCAGCAGGAAGTGTCCAGCAATTAGGGAAATGGTTTTCCAGTTGCAGAGGGAATGCTATCTGAAGCATGACCTGTGCTCCGCAGCCCAGGAGAACGTCGGTGTGATTGTGGAGATGATTCATTTCAAGGATCTCCTGCTGCATGAGCCCTATGTGGACCTTGTGAACCTGCTGCTGACCTGCGGGGAAGATGTGAAGGAGGCAGTCACCCGCAGCGTCCAGGCTCAGTGTGAACAG

Gene Information

mouse ... STAT1(20846), Stat1(20846)

Gene Information

mouse ... STAT2(20847), Stat2(20847)

Gene Information

mouse ... STAT6(20852), Stat6(20852)

Gene Information

mouse ... STC2(20856), Stc2(20856)

Ensembl | mouse accession no.

ENSMUSG00000026104

Ensembl | mouse accession no.

ENSMUSG00000040033

Ensembl | mouse accession no.

ENSMUSG00000002147

Ensembl | mouse accession no.

ENSMUSG00000020303

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NM_009283

NCBI accession no.

NM_019963

NCBI accession no.

NM_009284

NCBI accession no.

NM_011491

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Takashi Shimizu et al.
Science signaling, 14(667) (2021-01-28)
Pulmonary arterial hypertension (PAH) is a fatal disease characterized by excessive pulmonary vascular remodeling. However, despite advances in therapeutic strategies, patients with PAH bearing mutations in the bone morphogenetic protein receptor type 2 (BMPR2)-encoding gene present severe phenotypes and outcomes.
EunBin Kong et al.
Cell death and differentiation, 27(8), 2517-2530 (2020-03-05)
Autophagy is a cellular catabolic process that maintains intracellular homeostasis using lysosomal degradation systems. We demonstrate that inhibiting autophagy by depleting essential autophagy elongation proteins, Atg5 or Atg7, induces ISG15 expression through STING-mediated cytosolic dsDNA response. Genome stability is impaired
Chaoyong He et al.
Nature communications, 6, 7770-7770 (2015-07-18)
Platelet-derived growth factor (PDGF) is a mitogen and chemoattractant for vascular smooth muscle cells (VSMCs). However, the direct effects of PDGF receptor β (PDGFRβ) activation on VSMCs have not been studied in the context of atherosclerosis. Here we present a
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service