MilliporeSigma
All Photos(1)

Documents

EMU085661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mecp2

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTGACCGAGAGAGTTAGCTGACTTTACATAGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCGGGGTGGGAGTAGTTGGAGCATTGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAGCTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCACTCCCCCCAACAATATCCTCCCTCTTCCCCCCCCCCACCCCCGCCCCGTGTGCTCGTTAGGGCAATTGAGAGGACACTCCCATTTTTGGTGCCATTGATGCCCTGTCCATAATAGCTTCCCTGACTTTTACACCACCCCAACTCCCAATCTGAAGGACTGGGAGGTGTGATG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU031041EMU054411EMU080141
vibrant-m

EMU085661

MISSION® esiRNA

vibrant-m

EMU031041

MISSION® esiRNA

vibrant-m

EMU054411

MISSION® esiRNA

vibrant-m

EMU080141

MISSION® esiRNA

Gene Information

mouse ... MECP2(17257), Mecp2(17257)

Gene Information

mouse ... MEA1(17256), Mea1(17256)

Gene Information

mouse ... MCF2L(17207), Mcf2l(17207)

Gene Information

mouse ... NAPB(17957), Napb(17957)

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

esiRNA cDNA target sequence

CCGTGACCGAGAGAGTTAGCTGACTTTACATAGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCGGGGTGGGAGTAGTTGGAGCATTGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAGCTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCACTCCCCCCAACAATATCCTCCCTCTTCCCCCCCCCCACCCCCGCCCCGTGTGCTCGTTAGGGCAATTGAGAGGACACTCCCATTTTTGGTGCCATTGATGCCCTGTCCATAATAGCTTCCCTGACTTTTACACCACCCCAACTCCCAATCTGAAGGACTGGGAGGTGTGATG

esiRNA cDNA target sequence

CCCTCAATCAAGACCCTGAACAAGAAGAGGTGGAATTGGCACCAGTGGGTGAAGGAGAAGATGGAGCTGCTGACATCCAAGATCGGATCCAGGCCCTGGGGCTTCATCTGCCAGACCCTCCATTGGAGAGTGAGGATGAAGATGAGGAGGGAGCCGCCGCATTGAGCAGCCACAGCTCTATCCCCATGGACCCAGAACATGTAGAGCTGGTGAAAAGGACGATGGCTGGAGTAAGCCTGCCTGCACCAGGGGTTCCTGCCTGGGCTCGGGAGATCTCGGACGCTCAGTGGGAAGATGTGGTACAGAAAGCCCTCCAAGCCCGGCAGGCATCCCCTGCCTGGAAGTGACCAGAGAGCGAGCTGCCTTACCTCCCTACATTCCAAGTCAGGACCAGCACAGGACTAACAACTCTGGTCTTAACAGCCTCCTCCTTCCCATGTCCCTTTCACACCAAGGCGACTCAGACCTCTC

esiRNA cDNA target sequence

GAAGAAGCTGGACCACAAGCTGAGCCTGGACTCCTACCTGCTGAAACCTGTGCAGAGGATAACCAAGTACCAGCTGCTGCTCAAGGAAATGCTGAAGTACAGCAAGCACTGTGAAGGGGCAGAGGACCTGCAGGAGGCGCTGAGCTCCATCCTGGGCATCCTCAAGGCTGTGAACGACTCCATGCATCTCATCGCCATCACTGGCTATGATGGAAACCTTGGCGACCTGGGGAAGCTGCTGATGCAAGGTTCCTTCAGCGTGTGGACAGACCACAAGAAGGGCCACACCAAAGTGAAGGAGCTAGCCAGGTTCAAGCCCATGCAGCGGCACCTGTTTCTGCACGAGAAGGCCGTCCTCTTCTGCAAGAAGAGGGAGGAGAATGGGGAGGGATACGAGAAGGCTCCTTCCTACAGCTACAAGCAGTCCTTGAATATGACGGCTGTCGGCATCACAGAGAACGTGAAGGGTGACACC

esiRNA cDNA target sequence

GCTTTGTGGATGCTGGAAATGCGTACAAGAAAGCAGACCCTCAAGAGGCTATCAACTGCTTAAATGCAGCCATCGACATTTACACAGACATGGGGAGGTTCACAATCGCAGCCAAGCACCATATCACCATTGCCGAGATCTATGAGACTGAGCTCGTGGACATTGAGAAGGCTATTGCACACTATGAACAATCTGCTGATTACTACAAAGGAGAGGAATCTAACAGCTCTGCCAACAAGTGTCTGCTGAAGGTGGCAGCCTACGCTGCACAGCTGGAGCAGTACCAGAAAGCCATCGAGATCTATGAGCAGGTGGGAGCAAACACCATGGATAACCCCTTGTTGAAGTACAGTGCAAAGGATTACTTCTTCAAGGCCGCGCTCTGCCACTTCATAGTGGATGAGCTGAACGCAAAGCTTGCTCTGGAGAAATACGAGGAAATGTTTCCAGCATTTACGGACTCC

NCBI accession no.

NM_010788

NCBI accession no.

NM_010787

NCBI accession no.

NM_001159485

NCBI accession no.

NM_019632

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Ryuta Tanimoto et al.
Endocrinology, 156(1), 58-70 (2014-11-05)
The growth factor progranulin is as an important regulator of transformation in several cellular systems. We have previously demonstrated that progranulin acts as an autocrine growth factor and stimulates motility, proliferation, and anchorage-independent growth of castration-resistant prostate cancer cells, supporting
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.
Anja Rogler et al.
Journal of cancer research and clinical oncology, 141(10), 1779-1790 (2015-03-04)
We previously showed that the Wnt-signaling antagonist SFRP1 (secreted frizzled-related protein 1) is a promising marker in bladder cancer. The aim of this study was to validate the prognostic role and analyze the functional significance of SFRP1. Four bladder cancer
V O Okoh et al.
British journal of cancer, 112(10), 1687-1702 (2015-05-13)
17β-Oestradiol (E2)-induced reactive oxygen species (ROS) have been implicated in regulating the growth of breast cancer cells. However, the underlying mechanism of this is not clear. Here we show how ROS through a novel redox signalling pathway involving nuclear respiratory
Balaram Thota et al.
Journal of neurosurgery, 121(2), 374-383 (2014-06-01)
Insulin-like growth factor binding proteins (IGFBPs) have been implicated in the pathogenesis of glioma. In a previous study the authors demonstrated that IGFBP-3 is a novel glioblastoma biomarker associated with poor survival. Since signal transducer and activator of transcription 1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service