MilliporeSigma
All Photos(1)

Documents

MIRAP00097

Sigma-Aldrich

MystiCq® microRNA qPCR Assay Primer

hsa-miR-34a-5p

Sign Into View Organizational & Contract Pricing

NACRES:
NA.55

form

liquid

concentration

10 mg/mL

mature sequence

UGGCAGUGUCUUAGCUGGUUGU

mp

~77 °C

Sanger mature/minor accession no.

shipped in

wet ice

storage temp.

−20°C

Gene Information

human ... MIR34A(407040)

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
MIRAP00098MIRAP00102MIRAP00101
Gene Information

human ... MIR34A(407040)

Gene Information

human ... MIR34A(407040)

Gene Information

human ... MIR34C(407042)

Gene Information

human ... MIR34C(407042)

form

liquid

form

liquid

form

liquid

form

liquid

shipped in

wet ice

shipped in

wet ice

shipped in

wet ice

shipped in

wet ice

concentration

10 mg/mL

concentration

10 mg/mL

concentration

10 mg/mL

concentration

10 mg/mL

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

The MystiCq® microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq® microRNA SYBR® Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.

Features and Benefits

  • Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
  • Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
  • No self-complementarity or primer dimer artifacts with the Universal PCR Primer
  • Optimized primer Tm designed to match the Universal PCR Primer
  • Universal cycling conditions ensures robust amplification for all assays in profiling experiments
  • Optimized PCR product Tm (75-78° C)

Other Notes

Formerly hsa-miR-34a. Compatible with mmu-miR-34a and rno-miR-34a.

Legal Information

MystiCq is a registered trademark of QIAGEN Beverly Inc.
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
SYBR is a registered trademark of Life Technologies

Storage Class

12 - Non Combustible Liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Zhen Li et al.
Experimental and therapeutic medicine, 18(5), 3936-3942 (2019-10-17)
miRNA-34a is a tumor suppressor that is expressed in a variety of different types of cancer. The current study aimed to determine the involvement of miRNA-34a in triple negative breast cancer. miRNA-34a expression was detected using reverse transcription-quantitative PCR in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service