207-280-5

Applied Filters:

Keyword:'207-280-5'

Showing 1-30 of 92 results for "207-280-5" within Technical Documents

120 140 160 180 200 220 240 260 280 300 320 0 10000 20000 30000 40000 50000 60000 m/z Abundance 43 55 67 77 91 107 121 147 159 174 193 207

Data Sheet - D3162 - Lot 31K8806

0000 2000 4000 m/z Abundance 51 63 77 103 126 138 151 163 179 193 207 228 242 269 Hewlett-Packard 5890 Series II Gas Chromatograph Hewlett-Packard 5971

Data Sheet - D3162 - Lot 118H88021

5000 6000 m/z Abundance 51 63 77 89 103 111 126 138 151 163 178 193 207 214 228 242 270 Mattson Galaxy 3020 FT-IR

Data Sheet - C1037 - Lot 22K8805F

40000 50000 m/z Abundance 44 51 63 75 89 95 115 128 139 152 165 177 193 207 219 236 Hewlett-Packard 5890 Series II Gas Chromatograph Hewlett-Packard 5971 Mass Selective

Data Sheet - D3162 - Lot 22K88061

10000 12000 m/z Abundance 41 51 63 77 89 103 111 126 138 151 163 178 190 207 228 242 256 269 Hewlett-Packard 5890 Series

Data Sheet - D3162 - Lot 22K8806

10000 12000 m/z Abundance 41 51 63 77 89 103 111 126 138 151 163 178 190 207 228 242 256 269 Hewlett-Packard 5890 Series II Gas Chromatograph Hewlett-Packard

Aldolase Antibody 38C2

murine catalytic monoclonal antibody Aldrich Catalog Nos. 47,995-0 and 48,157-2 5/99 4 pages Technical Bulletin AL-207 INTRODUCTION Reactive immunization is a powerful method for the generation

Data Sheet - C1037 - Lot 22K8805

40000 50000 m/z Abundance 44 51 63 75 89 95 115 128 139 152 165 177 193 207 219 236 Hewlett-Packard 5890 Series II Gas Chromatograph Hewlett-Packard 5971

Data Sheet - C6395 - Lot 71K88051

70 eV Electron Ionization Mass Spectrum Abundance 43 67 91 107 121 147 174 193 207 231 246 271 299 314 50 100 150 200 250 300 0 4000

Quality Control Range Sheet- CYT-107 and CYT-207

577 pg/mL GRO Control 1 58 – 120 pg/mL Control 2 1376 – 2858 pg/mL Control 2 280 – 581 pg/mL IL-5 Control

TB415VM pET-47b(+) Vector Map

147 1987 3164 3426 3703 SphI 1 669 SspI 2 4185 4753 StuI 1 280 StyI 3 57 131 275 TaqII 4 1993 2960 4514 4865 TatI 2 283 2862 TspGWI 5 274 2183 2501 4069 4081 Tth111I 1 2803 XbaI 1 402 XcmI 3 1050 1566

Data Sheet - A7011

Velvick, S.F., J. Biol. Chem., 207, 225-244 (1954). 4. Wothington Enzyme Manual, Worthington, V., ed., Worthington Biochemical Corporation (Freehold, NJ: 1988), p 16. 5. Buhner, M., and Sund, H.

Data Sheet - A3263

C Product Description EC Number: 1.1.1.1 CAS Number: 9031-72-5 Molecular Weight: 141-152 kDa1,2 Extinction Coefficient: E1% = 14.6 (280 nm, water)3 pI: 5.4-5.84 Synonym: ADH Alcohol dehydrogenase

TB263 PreACTTM Activated Resins

PreACT TM Activated Resins TB263 11/99 Novagen 1United States & Canada 800-207-0144Germany 0800 6931 000 United Kingdom 0800 622935 Or your local sales office Table of Contents PreACT Activated

TB417VM pET-49b(+) Vector Map

4426 SpeI 1 417 SphI 1 1392 SspI 2 4908 5476 StuI 1 280 StyI 3 57 131 275 SwaI 1 660 TaqII 4 2716 3683 5237 5588 TatI 3 283 512 3585 TspGWI 5 274 2906 3224 4792 4804 Tth111I 1 3526 XbaI 1 1125 XcmI

TB416VM pET-48b(+) Vector Map

Cat. No. pET-48b(+) Cloning Kit 71462-3 Novagen • ordering 800-526-7319 • technical support 800-207-0144 A Brand of EMD Biosciences, Inc., an Affi liate of Merck KGaA, Darmstadt, Germany Novagen®

MOUSE ANTI-HUMAN NUCLEAR SPLICEOSOMES MONOCLONAL ANTIBODY - Data Sheet

Cytometry 6:208-214 (1985). 2. Exp. Cell Res. 151:194-207 (1984). 3. J. of Cell. Physiology 130:336-343 (1987). 4. Cytometry 8:280-286 (1987). 5. J. of Histochem. Cytochem. 32,7:757-765 (1984). 6

TB135VM pT7Blue-2 Vector

319 ApoI 4 130 253 526 537 AvaI 3 189 280 318 AvaII 2 1510 1732 AvrII 1 286 BaeI 1 156 BamHI 1 228 BanI 4 157 761 1921 3018 BanII 4 190 319 325 799 BbvI 15 BccI 5 714 731 1425 1712 1836 Bce83I 4 1270 2138

Product Information Sheet - S1638

appropriate column. Wash with 5-10 column volumes of PBS. 2. Apply the sample that contains the biotinylated protein. 3. Wash with PBS until the absorbance at 280 nm is minimal. 4.

TB044VM pET-14b Vector Map

Enzyme # Sites Locations AatII 1 4598 AccI 2 960 2553 AceIII 5 1005 2292 2433 2735 3975 AciI 72 AflIII 1 2783 AluI 18 AlwI 14 Alw21I 8 280 899 1486 1777 2601 3101 4262 4347 Alw44I 3 2597 3097 4343 AlwNI

Ni-NTA HisﾕBind® Resins

5. Equilibrate column with 5 column volumes of 1X Ni-NTA Bind Buffer. The flow rate should not exceed 2 ml/min. Monitor elution at 280 nm; the baseline should be stable after washing with 5 column

TB040VM pET-9a-d Vector Map

pET-9a-d TB040 10/98 Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 TB040 12/98 AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA

TB026VM pET-3a-d Vector Map

Enzyme # Sites Locations AatII 1 4567 AccI 2 929 2522 AceIII 5 974 2261 2402 2704 3944 AciI 86 AflIII 1 2752 AluI 18 AlwI 14 Alw21I 8 280 868 1455 1746 2570 3070 4231 4316 Alw44I 3 2566 3066 4312 AlwNI

Bright prospects - Solvents for spectroscopy Uvasol®EMD

at [nm] Content / Packaging Ord. No. 254 nm 365 nm E Ethanol 99.9 0.0002 0.05 1.0 1.0 207 (20 %), 220 (55 %), 235 (80 %), 240 (85 %), 245 (90 %)

Data Sheet - P4762

R.E., et al., J. Biol. Chem., 245, 3485-3492 (1970). 17. Smith, E.L., et al., J. Biol. Chem., 207, 533-549 (1954). 18. Sluyterman, L.A., and de Graaf, M.J., Biochim. Biophys. Acta, 258, 554-561

TB258VM pETBlue™-1 Vector Map

ORF RBS pETBlueT7UP primer #70725-3 Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 TB258 12/99 lacZ f1 or ig in (9 19 -1 37 6) Ap (1492-1949) or i (

Data Sheet - P3125

). 16. Mitchel, R. E., et al., J. Biol. Chem., 245, 3485- 3492 (1970). 17. J. Biol. Chem., 207, 533 (1954). 18. Sluyterman, L. A., and de Graaf, M.J., Biochim. Biophys. Acta, 258, 554-561 (

Data Sheet - F6796

Factor Res., 1, 207 (1989). 3. Givol, D. and Yayon, A., FASEB. J., 6, 3362 (1992). 4. Baird, A., et al., Curr. Opin. Neurobiol., 4, 78 (1994). 5. Yayon, A., et.al., EMBO J., 5, 1885 (1992). 6.

TB397VM pET-46 Ek/LIC Vector Map

T7 Terminator Primer (Cat. No. 69337-3). Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 TB397 0903pET-46 Ek/LIC Vector pET-46 Ek/LIC sequence landmarks T7 promoter 315–331 T7 transcription

Data Sheet - F0425

Factor Res., 1, 207 (1989). 3. Givol, D., and Yayon, A., FASEB. J., 6, 3362 (1992). 4. Baird, A., et al., Curr. Opin. Neurobiol., 4, 78 (1994). 5. Yayon, A., et al., EMBO J., 5, 1885 (1992).

Page 1 of 4