207-540-8 | Sigma-Aldrich

TB256 Sidewinder Genomic DNA Purification Kit

Sidewinder TM Genomic DNA Purification Kit TB256 10/99 Novagen 1 United States & Canada 800-207-0144 Germany 0800 6931 000 United Kingdom 0800 622935 Or your local sales office Sidewinder Genomic

Quality Control Ranges: MILLIPLEX® MAP Human Cytokine/ Chemokine Magnetic Bead Panel

Control 2 492 – 1022 pg/mL Control 2 468 – 972 pg/mL FGF-2 Control 1 100 – 207 pg/mL IL-2 Control 1 98

TB029

BsrFI 6 172 181 540 700 1054 3219 Bst1107I 1 2017 BstYI 9 4 140 1438 2887 2898 2984 2996 3764 3781 Enzyme # Sites Locations Cac8I 29 CjeI 18 CjePI 16 CviJI 68 CviRI 20 DdeI 8 1352 1514 2054 2521

Product Information Sheet - S4760

7. Boyd, D.W., Jr., Ann. Entomol. Soc. Am., 96(5), 667-671 (2003). 8. Choi, H.-J. et al., Korean J. Plant Res., 32(3), 207-219 (2019). 9. Young, Mason, "Microdialysis Studies Using Porcine Pancreatic

Product Information Sheet - E7637

(1997). 23. Sigma-Aldrich Material Safety Data Sheet (MSDS). 24. Joshua, H., BioTechniques, 4 (3), 207-208 (1986). 25. Lunn, G. and Sansone, E.B., Biotech. Histochem., 66, 307-315 (1991). 26. Lunn, G

XP725 Antibody Number-Lot Number 071M4826

248 269 270 271 272 3.3 201 202 203 204 225 226 227 228 249 250 251 252 273 274 275 276 3.4 205 206 207 208 229 230 231 232 253 254 255 256 277 278 279 280 3.5 209 210 211

TB040VM pET-9a-d Vector Map

pET-9a-d TB040 10/98 Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 TB040 12/98 AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA

Product Information Sheet - E1385

(1997). 23. Sigma-Aldrich Material Safety Data Sheet (MSDS). 24. Joshua, H., BioTechniques, 4 (3), 207-208 (1986). 25. Lunn, G. and Sansone, E.B., Biotech. Histochem., 66, 307-315 (1991). 26. Lunn, G

TB214VM pSTBlue-1 Vector

pSTBlue-1 TB214 10/98 Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 TB214 12/98 Kpn I Sph I Pst I

TB044VM pET-14b Vector Map

pET-14b TB044 10/98 Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 ori (2845) A p (3 60 6- 44 63 ) Cla I(24) Hind III(29) Nhe I(229) Bpu1102

TB397VM pET-46 Ek/LIC Vector Map

T7 Terminator Primer (Cat. No. 69337-3). Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 TB397 0903pET-46 Ek/LIC Vector pET-46 Ek/LIC sequence landmarks T7 promoter 315–331 T7 transcription

TB026VM pET-3a-d Vector Map

4093 Bce83I 7 399 962 1132 2843 3141 3382 4250 BcefI 3 887 1444 3254 BcgI 8 506 540 974 1008 2329 2363 4150 4184 BfaI 8 230 448 544 589 1766 3247 3500 3835 BglI 3 1212 1446 3765 BglII 1 646 BpmI

XP725 Antibody List Lot 129K4831

P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 577 phospho-PKB (pSer473) P4112 207 AKT1

XP725 Antibody List Lot 129K4830

P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 577 phospho-PKB (pSer473) P4112 207 AKT1

XP725 Antibody List Lot 089K4791

P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 577 phospho-PKB (pSer473) P4112 207 AKT1

XP725 Antibody List

001101103.1 M y y y 574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y 575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1

XP725 Antibody List 013M4793

001101103.1 M y y y 574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y 575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1

Inhibitor Sourcebook 3rd Edition

.................................207 215921 .........................................128, 147, 210 216201 ...........................................................207 217504 ..........................

inNovations Newsletter #15

available from VWR International Telephone 800 932 5000 E-mail www.vwr.com Technical Service Phone 800 207 0144 E-mail [email protected] Comments regarding inNovations and suggestions or ideas for articles

List of Antibodies

C7785 M y n/d n/d 205 Cytokeratin peptide 7 C6417 M y n/d n/d 206 Cytokeratin 8.12 C7034 M y n/d n/d 207 Cytokeratin 8.13 C6909 M y n/d n/d 208 Cytokeratin peptide 13 C0791 M y n/d n/d 209 Cytokeratin Peptide

XP725 Worksheet for Lot Number 071M4826

1 1 8 Calmodulin C7055 201 2 1 2 1 Calnexin C4731 202 2 1 2 2 Calnexin C4731 203 2 1 2 3 Calponin C2687 204 2 1 2 4 Calponin C2687 205 2 1 2 5 Calreticulin C4606 206 2 1 2 6 Calreticulin

Inorganics & Solvents for classical analysis

.5 mm 50 g 0.75 L 142 mm 90 mm 90 mm min. 49 g 1.10 L 176 mm 90 mm 90 mm min. 55 g 1.25 L 207 mm 90 mm 90 mm min. 65 g

Empower your Lab

.5 mm 50 g 0.75 l 142 mm 91 mm 91 mm min. 49 g 1.10 l 176 mm 90 mm 90 mm min. 55 g 1.25 l 207 mm 90 mm 90 mm min. 65 g

Hallmarks of Cancer - Solutions for life science research

Safety and Survival With GVAX Pancreas Prime and Listeria Monocytogenes-Expressing Mesothelin (CRS-207) Boost Vaccines for Metastatic Pancreatic Cancer. J Clin Oncol. 2015 Apr 20;33(12):1325-33. Cancer

Halal Certificate

UNDECANONE NATURAL W309311 D12699 HC-24SIX453 206. 2-Undecen-1-Ol W406801 A99884 HC-24SI6543 207. 3-(METHYLTHIO)-1-HEXANOL W343803 C44272 HC-24SIAR01 208. 3-(METHYLTHIO)-1-HEXANOL NATURAL W343847

Halal Certificate

UNDECANONE NATURAL W309311 D12699 HC-22SIU951 206. 2-Undecen-1-Ol W406801 A99884 HC-22SI2S41 207. 3-(METHYLTHIO)-1-HEXANOL W343803 C44272 HC-22SIHP98 208. 3-(METHYLTHIO)-1-HEXANOL NATURAL W343847

User Guide accu-jet® S - multi language

Cor N.º Enc. branco 26658 Po rt ug uê s 997418 Instruções de utilização 207 Suporte da parede Cor N.º Enc. branco 26539 Fita adesiva Emb.