Search Within
Document Type
207-540-8
Applied Filters:
Keyword:'207-540-8'
Showing 1-27 of 27 results for "207-540-8" within Technical Documents
TB256 Sidewinder Genomic DNA Purification Kit
Sidewinder
TM
Genomic DNA Purification Kit
TB256 10/99 Novagen 1
United States & Canada 800-207-0144
Germany 0800 6931 000
United Kingdom 0800 622935
Or your local sales office
Sidewinder Genomic
Quality Control Ranges: MILLIPLEX® MAP Human Cytokine/ Chemokine Magnetic Bead Panel
Control 2 492 – 1022 pg/mL Control 2 468 – 972 pg/mL
FGF-2 Control 1 100 – 207 pg/mL IL-2 Control 1 98
TB029
BsrFI 6 172 181 540 700 1054
3219
Bst1107I 1 2017
BstYI 9 4 140 1438 2887 2898
2984 2996 3764 3781
Enzyme # Sites Locations
Cac8I 29
CjeI 18
CjePI 16
CviJI 68
CviRI 20
DdeI 8 1352 1514 2054 2521
Product Information Sheet - S4760
7. Boyd, D.W., Jr., Ann. Entomol. Soc. Am., 96(5),
667-671 (2003).
8. Choi, H.-J. et al., Korean J. Plant Res., 32(3),
207-219 (2019).
9. Young, Mason, "Microdialysis Studies Using
Porcine Pancreatic
Product Information Sheet - E7637
(1997).
23. Sigma-Aldrich Material Safety Data Sheet (MSDS).
24. Joshua, H., BioTechniques, 4 (3), 207-208 (1986).
25. Lunn, G. and Sansone, E.B., Biotech. Histochem.,
66, 307-315 (1991).
26. Lunn, G
XP725 Antibody Number-Lot Number 071M4826
248 269 270 271 272
3.3 201 202 203 204 225 226 227 228 249 250 251 252 273 274 275 276
3.4 205 206 207 208 229 230 231 232 253 254 255 256 277 278 279 280
3.5 209 210 211
TB040VM pET-9a-d Vector Map
pET-9a-d TB040 10/98
Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144
TB040 12/98
AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Product Information Sheet - E1385
(1997).
23. Sigma-Aldrich Material Safety Data Sheet (MSDS).
24. Joshua, H., BioTechniques, 4 (3), 207-208 (1986).
25. Lunn, G. and Sansone, E.B., Biotech. Histochem.,
66, 307-315 (1991).
26. Lunn, G
TB214VM pSTBlue-1 Vector
pSTBlue-1 TB214 10/98
Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144
TB214 12/98
Kpn I Sph I Pst I
TB044VM pET-14b Vector Map
pET-14b TB044 10/98
Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144
ori (2845)
A
p
(3
60
6-
44
63
)
Cla I(24)
Hind III(29)
Nhe I(229) Bpu1102
TB397VM pET-46 Ek/LIC Vector Map
T7
Terminator Primer (Cat. No. 69337-3).
Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144
TB397 0903pET-46 Ek/LIC Vector
pET-46 Ek/LIC sequence landmarks
T7 promoter 315–331
T7 transcription
TB026VM pET-3a-d Vector Map
4093
Bce83I 7 399 962 1132 2843 3141
3382 4250
BcefI 3 887 1444 3254
BcgI 8 506 540 974 1008 2329
2363 4150 4184
BfaI 8 230 448 544 589 1766
3247 3500 3835
BglI 3 1212 1446 3765
BglII 1 646
BpmI
XP725 Antibody List Lot 129K4831
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
577 phospho-PKB (pSer473) P4112 207 AKT1
XP725 Antibody List Lot 129K4830
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
577 phospho-PKB (pSer473) P4112 207 AKT1
XP725 Antibody List Lot 089K4791
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
577 phospho-PKB (pSer473) P4112 207 AKT1
XP725 Antibody List
001101103.1 M y y y
574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y
575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1
XP725 Antibody List 013M4793
001101103.1 M y y y
574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y
575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1
Inhibitor Sourcebook 3rd Edition
.................................207
215921 .........................................128, 147, 210
216201 ...........................................................207
217504 ..........................
inNovations Newsletter #15
available from
VWR International
Telephone 800 932 5000
E-mail www.vwr.com
Technical Service
Phone 800 207 0144
E-mail [email protected]
Comments regarding inNovations and
suggestions or ideas for articles
List of Antibodies
C7785 M y n/d n/d
205 Cytokeratin peptide 7 C6417 M y n/d n/d
206 Cytokeratin 8.12 C7034 M y n/d n/d
207 Cytokeratin 8.13 C6909 M y n/d n/d
208 Cytokeratin peptide 13 C0791 M y n/d n/d
209 Cytokeratin Peptide
XP725 Worksheet for Lot Number 071M4826
1 1 8 Calmodulin C7055
201 2 1 2 1 Calnexin C4731
202 2 1 2 2 Calnexin C4731
203 2 1 2 3 Calponin C2687
204 2 1 2 4 Calponin C2687
205 2 1 2 5 Calreticulin C4606
206 2 1 2 6 Calreticulin
Inorganics & Solvents for classical analysis
.5 mm 50 g
0.75 L 142 mm 90 mm 90 mm min. 49 g
1.10 L 176 mm 90 mm 90 mm min. 55 g
1.25 L 207 mm 90 mm 90 mm min. 65 g
Empower your Lab
.5 mm 50 g
0.75 l 142 mm 91 mm 91 mm min. 49 g
1.10 l 176 mm 90 mm 90 mm min. 55 g
1.25 l 207 mm 90 mm 90 mm min. 65 g
Hallmarks of Cancer - Solutions for life science research
Safety and Survival With GVAX Pancreas Prime and Listeria Monocytogenes-Expressing
Mesothelin (CRS-207) Boost Vaccines for Metastatic Pancreatic Cancer. J Clin Oncol. 2015 Apr
20;33(12):1325-33.
Cancer
Halal Certificate
UNDECANONE NATURAL W309311 D12699 HC-24SIX453
206. 2-Undecen-1-Ol W406801 A99884 HC-24SI6543
207. 3-(METHYLTHIO)-1-HEXANOL W343803 C44272 HC-24SIAR01
208. 3-(METHYLTHIO)-1-HEXANOL NATURAL W343847
Halal Certificate
UNDECANONE NATURAL W309311 D12699 HC-22SIU951
206. 2-Undecen-1-Ol W406801 A99884 HC-22SI2S41
207. 3-(METHYLTHIO)-1-HEXANOL W343803 C44272 HC-22SIHP98
208. 3-(METHYLTHIO)-1-HEXANOL NATURAL W343847
User Guide accu-jet® S - multi language
Cor N.º Enc.
branco 26658
Po
rt
ug
uê
s
997418 Instruções de utilização 207
Suporte da parede
Cor N.º Enc.
branco 26539
Fita adesiva
Emb.