Search Within
Document Type
213-207-8
Applied Filters:
Keyword:'213-207-8'
Showing 1-30 of 55 results for "213-207-8" within Technical Documents
Data Sheet - M1320
Monoclonal Anti-MTA1, clone MTA1-213 (M1320) - Data Sheet
Monoclonal Anti-MTA1 antibody produced in
mouse
clone MTA1-213, purified from hybridoma cell culture
Catalog Number M1320
Product
Product Information Sheet - M0880
, et al., Nature, 198, 447-8
(1963).
4. Merck Index, 11th ed., Entry# 3782.
5. Alderson, T., Chemically Induced Delayed
Germinal Mutation in Drosophila. Nature,
207(993), 164-167 (1965).
TB394VM pCDF-2 Ek/LIC Vector Map
I (1752)
Nco I (69)
Ava I (134)
Xho I (134)
Pml I (94)
Acc I (191)
Pac I (209)
Avr II (213)
BspM I (901)
GACTCCTGCATTAGGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTGTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
TB408 pCOLADuet™-1 Vector Map
1922
AclI 1 3564
Afl II 1 163
Afl III 1 3224
AgeI 1 566
ApaI 1 3021
ApaLI 1 3244
AscI 1 125
AseI 6 213 732 921 2482 2541
3702
AsiSI 1 337
AvaI 2 354 1246
AvrII 1 433
BaeI 1 365
BamHI 1 106
BanI 4 348
Data Sheet - E1528
(1998).
7. de Jager, T. et al., J. Biol. Chem., 276, 27873-
27880 (2001).
8. Yellayi, S. et al., Endocrine, 12, 207-213 (2000).
9. Suo,Z, et al. Virchows Arch., 439, 62-69 (2001).
10. Wyckoff, M.H.
Quality Control Ranges: MILLIPLEX® MAP Human Cytokine/ Chemokine Magnetic Bead Panel
pg/mL Control 2 498 – 1035 pg/mL
IFN α 2 Control 1 91 – 189 pg/mL IL-8 Control 1 102 – 213 pg/mL
Product Information Sheet - M7008
Description
Molecular Formula: C15H16O7
Molecular Weight: 308.3
CAS Number: 6734-33-4
Melting Point: 213-214 °C1
Specific Rotation: -42° (0.1% (w/v) in water)1
Synonyms: 4-Methylumbelliferyl-β-D-xyloside
Product Information Sheet - 11442066001
ready-to-use tablets 20 tablets 11 697 471 001
NBT/BCIP Stock Solution 8 ml 11 681 451 001
NBT Solution 3 ml
(300 mg)
11 383 213 001
NBT crystals 5 g 11 585 029 001
Labeling of Biomolecules
Product Information Sheet - P2277
1974).
7. Crouch, T. H. et al., Biochem., vol 19, 3692-3698
(1980).
8. Klee, C. and Vanaman, T., Adv. Protein Chem., 35,
213-321 (1982).
9. Means, A. et al., Physiol. Reviews, 62, 1-39 (1982)
10.
TB045VM pET-15b Vector Map
452
His•Tag coding sequence 362-380
Multiple cloning sites
(Nde I - BamH I) 319-335
T7 terminator 213-259
lacI coding sequence (866-1945)
pBR322 origin 3882
bla coding sequence 4643-5500
pET-15b cloning
TB049VM pET-19b Vector Map
start 471
His•Tag coding sequence 366-395
Multiple cloning sites
(Nde I -BamH I) 319-335
T7 terminator 213-259
lacI coding sequence 875-1954
pBR322 origin 3891
bla coding sequence 4652-5509
The pET-19b vector
XP725 Antibody Number-Lot Number 071M4826
251 252 273 274 275 276
3.4 205 206 207 208 229 230 231 232 253 254 255 256 277 278 279 280
3.5 209 210 211 212 233 234 235 236 257 258 259 260 281 282 283 284
3.6 213 214
TB046VM pET-16b Vector Map
start 465
His•Tag coding sequence 360-389
Multiple cloning sites
(Nde I -BamH I) 319-335
T7 terminator 213-259
lacI coding sequence 869-1948
pBR322 origin 3885
bla coding sequence 4646-5503
The pET-16b vector
TB390VM pCDFDuet™-1 Vector Map
AclI 1 3626
AflII 1 163
AflIII 2 1666 3286
AgeI 1 566
ApaI 1 3083
ApaLI 2 1193 3306
AscI 1 125
AseI 4 213 2544 2603 3764
AsiSI 1 337
AvaI 1 354
AvrII 1 433
BaeI 2 365 1972
BamHI 1 106
BanI 4 348 2517 2647
TB397VM pET-46 Ek/LIC Vector Map
(4958)
pET-46 Ek/LIC
5200 bp
Hinc II (1578)
Ava I (176)
Xho I (176)
Pml I (220)Avr II (213)
Nco I (241)
GATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
TB042VM pET-11a-d Vector Map
landmarks
T7 promoter 432-448
T7 transcription start 431
T7•Tag coding sequence 328-360
T7 terminator 213-259
lacI coding sequence 835-1914
pBR322 origin 3851
bla coding sequence 4612-5469
The maps for
Product Information Sheet - PR0100
At4g26070 226
G1 At2g13790 225
G2 At2g32210 169
G3 At4g11370 213
G4 At4g34390 189
G5 At5g47910 207
G6
Product Information - CSAA1
Clone:PK-G4 P8083 Signal Transduction M n/d n/d y
212 PKD P3987 Signal Transduction P y y n/d
213 Map Kinase Phosphatase-1 (MKP-1) M3787 Signal Transduction P y n/d n/d
214 Protein phosphatase 1α
XP725 Antibody List Lot 129K4831
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
577 phospho-PKB (pSer473) P4112 207 AKT1
XP725 Antibody List Lot 129K4830
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
577 phospho-PKB (pSer473) P4112 207 AKT1
XP725 Antibody List Lot 089K4791
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y
577 phospho-PKB (pSer473) P4112 207 AKT1
Chrombook 2015 - The world of chromatography in your hands
68, 108, 188, 192,
194, 196, 199, 201, 202, 207, 230, 244, 262,
283, 308, 309, 312, 325, 329, 342, 408, 410
C9 – C18 457
Cost savings 213
Customized HPLC column
Inhibitor Sourcebook 3rd Edition
407721 ...........................................................207
407850 .......................................................... 213
407900 .........................................................
Research Article: MCP-1, KC-like and IL-8 as critical mediators of
canine
babesiosis is associated with a consumptive coagulopathy. Veterinary Journal. 2013; 196(2):213–7.
48. Mackness B, Hine D, Liu YF, Mastorikou M, Mackness M. Paraoxonase-1 inhibits oxidised LDL-induced
Product Information Sheet - HPFM2
immobilisation of biomolecules in a microarray (2004), Combinatorial
Chemistry & High Throughput Screening, 7, 213-221, Yeo DSY, Panicker RC, Tan L-P
and Yea SQ
4. Enzymatic activity on a chip: The critical role
Product Information Sheet - HPFM3
immobilisation of biomolecules in a microarray (2004), Combinatorial Chemistry &
High Throughput Screening, 7, 213-221, Yeo DSY, Panicker RC, Tan L-P and Yea SQ.
4. Enzymatic activity on a chip: The critical role
XP725 Antibody List 013M4793
001101103.1 M y y y
574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y
575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1
Panorama Human Protein Functional Array-Signal Transduction
immobilisation of biomolecules in a microarray (2004), Combinatorial Chemistry &
High Throughput Screening, 7, 213-221, Yeo DSY, Panicker RC, Tan L-P and Yea SQ.
4. Enzymatic activity on a chip: The critical role
XP725 Antibody List
001101103.1 M y y y
574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y
575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1
User Guide - Milli-Q® HX and HR 7000 Series
Milli-Q® HR 7060 72 / 159 91 / 200 222/489
Milli-Q® HR 7120 75 / 165 94 / 207 225/496
Milli-Q® HR 7170 78 / 172 97 / 213 228/502
Milli-Q® HR 7220 84 / 185 103
Page 1 of 2