Skip to Content
MilliporeSigma
Search Within
Document Type

526-55-6

Applied Filters:
Keyword:'526-55-6'
Showing 1-30 of 46 results for "526-55-6" within Technical Documents
TB347 pSiExTM-1 Cloning Kit
Word - TB347 pSiEx Vector Rev. B 0704.doc Novagen USA and Canada Tel (800) 526-7319 [email protected] Germany Tel 0800 100 3496
TB233 Clonables™ Kit
for preparation of IPTG/X-gal plates. Clonables TM Kit 6 Novagen TB233 01/99 United States & Canada Orders: 800 526-7319 Technical Service: 800 207-0144 Transformation - Detailed Protocol
TB017VM pT7Blue Vector Map
2281 SmaI 1 106 SpeI 1 81 SphI 1 55 Sse8387I 1 61 SspI 2 300 853 TaqI 5 64 118 541 1004 2448 TaqII 6 412 956 973 1126 1311 2650 TfiI 2 2572 2712 ThaI 11 TseI 12 Tsp45I 4 148 681 1185 1396 Tsp509I 10 120
Product Information Sheet - SAE0093
et al., Glycobiology, 8(5), 517-526 (1998). 5. Powell, J.T., and Brew, K., Biochem. J., 142(2), 203-209 (1974). 6. Hanßke, B. et al., J. Clin. Invest., 109(6), 725-733 (2002). 7. Molyneux
Data Sheet - A4594
96, 495-506 (1999). 5. Brown, H. A., et al., Cell, 75, 1137-1144 (1993). 6. Cockcroft, S., et al., Science, 263, 523-526 (1994). 7. Zhao, L., et al., Proc. Natl. Acad. Sci. USA, 94, 4418-4423
Radiance! Multisystem Protein Expression
Insert 1 • 8 µl LIC Duet Control Insert 2 6 Accessory Products Radiance™ Buying Guide Competent Cells Orders Phone 800 526 7319 Novagen •
TB240VM pET-42a-c(+) Vector Map
(+) (5930 bp) pET-42a(+) GST• Tag (433-1092) lacI (1571-2653) ori (3847) Ka n (4 55 6- 53 71 ) f1 o ri (54 71-5918) Bpu1102 I(80) PinA I(289) Kpn I (296) Bgl II (299
Monoclonal Anti-Procathepsin L Clone CPLH-2D4 (C0994)
Clin. Invest., 112, 517-526 (2003). 4. Turk, B., and Stoka, V., FEBS Lett., 581, 2761- 2767 (2007). 5. Igdoura, S.A., et al., J. Histochem. Cytochem., 43, 545-557 (1995). 6. Kirschke, H., et al.
Monoclonal Anti-Cathepsin L Clone CPL33/1 (C4618)
., Eur. J. Biochem., 74, 293-301 (1977). 6. Heidtmann, H.H., et al., Oncology Res., 5, 441-451 (1993). 7. Denhardt, D.T., et al., Oncogene, 2, 55-59 (1987). 8. Weber, E., et al., J. Cancer Res
Data Sheet - 01337
isolation-cultivation-identification-maintenance of medical bacteria, vol. 1, p. 522-526. Williams & Wilkins, Baltimore, MD (1985) 6. R.R. Facklam, J.A. Washington II., Streptococcus and related catalase-negative
TB047VM pET-17b Vector Map
EciI 3 1492 1638 2466 Eco47III 1 672 Eco57I 2 1966 2978 EcoO109I 4 55 382 424 3287 EcoRI 1 174 EcoRII 4 384 1444 1565 1578 EcoRV 1 166 FauI 6 348 433 714 900 1121 1131 FokI 8 637 699 777 963 1104 2277
TB214VM pSTBlue-1 Vector
Locations FokI 6 272 1308 1595 1776 2035 2641 FspI 2 352 1524 HaeII 4 748 756 3270 3640 HaeIII 17 HgaI 5 78 814 1215 2820 3398 HhaI 24 HincII 1 114 HindIII 1 118 HinfI 13 HphI 12 KpnI 1 55 MaeIII 17 MboII
TB417VM pET-49b(+) Vector Map
pET-49b(+) cloning/expression region Cat. No. pET-49b(+) DNA 71463-3 Novagen • ordering 800-526-7319 • technical support 800-207-0144 A Brand of EMD Biosciences, Inc., an Affi liate of Merck KGaA
Data Sheet - SRP5061
PHKG1 or six other candidate genes explain only a minority of cases. Europ. J. Hum. Gen., 11, 516- 526 (2003). 2. Wehner, M. et al., Human cDNA encoding the muscle isoform of the phosphorylase kinase
XP725 Antibody Number-Lot Number 071M4826
4 25 26 27 28 49 50 51 52 73 74 75 76 1.2 5 6 7 8 29 30 31 32 53 54 55 56 77 78 79 80 1.3 9 10 11 12 33 34 35 36 57 58 59
TB064 pET-23(+) Vector Map
pET-23(+) TB064 10/98 Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 ori (1 37 6) A p (2137-2994) f1 ori gin (31 26-35 81) Bpu1102 I(80) Xho I(158
An Accelerated Method for Production of Recombinant Proteins using UCOE Expression Technology
03 2. Ohlsson R, Kanduri C. New Twists on the Epigenetics of CpG Islands. Genome Res. 12, 525-526 (2002) 3. Dillon N, Grosveld F. Chromatin domains as potential units of eukaryotic gene function
TB297 pTriEx-3 Neo Vector Map
promoter lac operator Exon 1 Exon 2 Rabbit β globin terminator T7 terminator Ap (55 23-6 383) or i ( 49 24 ) Nco I (2112) EcoR V (2121) Sma I (2126) Ecl136 II (2131) BamH I
TB051VM pET-23a-d(+) Vector Map
pET-23a-d(+) TB051 10/98 Novagen • ORDERING 800-526-7319 • TECHNICAL SUPPORT 800-207-0144 TB051 12/98pET-23a-d(+) Vectors AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
TB294 pTriEx-1.1 Hygro Vector Map
EcoO109I 7 1927 1928 2208 2562 2919 2973 4470 EcoRI 1 2362 EcoRII 11 EcoRV 1 2340 FauI 23 Fnu4HI 55 FokI 6 2891 3425 3798 6068 6249 6536 FseI 1 1017 FspI 2 659 6324 HaeII 3 1864 4638 5615 HaeIII 30 HgaI
Cell-Based Receptor Binding Assays Performed with the MultiScreen Assay System
C5a Receptor from Human Polymorphonuclear Leukocytes," Journal of Biological Chemistry, 263: 520 – 526 (1988). 4. Pitt, Aldo M., "The Nonspecific Protein Binding of Polymeric Micro- porous Membranes
Nitrate Spectroquant Test Kits Method 2017
71 3 1. 00 61 4 nm 1. 14 54 2 1. 14 94 2 1. 14 77 3 1. 14 55 6 nm 1. 01 84 2 332
Nitrate Spectroquant Test Kits Equivalency Report 2017
55 6 nm 1. 01 84 2 nm T N T 8 35 T N T 8 36 nm St an da rd M
New Research Tools for Signal Transduction and Life Science Research
PK1109 50 ml $209 PhosphoDetect™ Anti-Syk (pTyr525/526) Rabbit pAb Recognizes the ~72 kDa Syk protein phosphorylated at Tyr525/526 in human Syk or Tyr519/520 in mouse Syk in 29�T cells expressing
Formulation Portfolio: Make your choice
precipitated (≤ 0.0005% Al) EMPROVE® ESSENTIAL USP, FCC, E 526 102110 Calcium hydroxide EMPROVE® ESSENTIAL Ph Eur, BP, USP, JP, FCC, E 526 102102 Calcium lactate pentahydrate EMPROVE® ESSENTIAL
ExPlore with Confidence: Prestige Antibodies Breast Cancer Research
, HER2 is detected in the breast cancer cell line SK-BR-3. 250 130 95 72 55 36 28 17 10 6. Pohler E et al. Haploinsufficiency for AAGAB causes clinically
Protein Tyrosine Phosphatases- Potential Roles in Disease
46. Ungefroren, H., et al., J. Cell. Sci., 114, 2735-2746 ( 2001). 47. Irie, S., DNA Seq., 11, 519-526 (2001). 48. Lee, S.W., et al., Mol. Cell. Biol., 20, 1723-1732 (2000). 49. Osborne, J.M., et al., J
inNovations Newsletter #18
described in Table 1, page 17, with annealing at 55°C. Target sequences included b-globin, protein S, and HLA DPB1, shown in panel A, and mitochondrial DNA, p53 exon 6, and p53 exon 11, shown in panel B. One tenth
inNovations Newsletter #17
Canada EMD Biosciences, Inc. 441 Charmany Drive Madison, WI 53719 U.S.A. Main Desk: Tel: 800 526 7319 Ordering: Tel: 800 854 3417 Tel: 608 238 6110 Fax: 608 238 1388 e-mail: [email protected]
inNovations Newsletter #14
proximately 2 cm × 1.5 cm × 0.5 cm. Please contact our histology group in the United States by phone at 800-526-7319, by fax at 608-238-1388, or email at [email protected]. New Hybrid-Ready Tissues Tissue
Page 1 of 2