Skip to Content
MilliporeSigma
Search Within
Document Type

695-99-8

Applied Filters:
Keyword:'695-99-8'
Showing 1-24 of 24 results for "695-99-8" within Technical Documents
Data Sheet - MSST0057
(amino acids) Relative Abundance (%) 21-99 9108.6 79 12.6 23-99 8922.5 77 66.5 28-99 8385.7 72 20.9 Interleukin-8 (IL-8) is a member of the CXC chemokine subfamily
Data Sheet - I2908
Natl. Acad. Sci. USA, 80, 5842-5846 (1983). 3. Vogel, S.N., et al., Infect. Immunol., 38, 681-695 (1982). 4. The Cytokine Facts Book, Eds., Callard, R., and Gearing, A., pp. 157-158, Academic
Data Sheet - T1152
10. Ito, T. et al.; Isolation and structure of tunicamycin components., Agric. Biol. Chem. 44, 695 (1980). 11. Duksin, D. and Mahoney, W.C., Relationship of the structure and biological activity
Data Sheet - T0527
10. Ito, T. et al.; Isolation and structure of tunicamycin components., Agric. Biol. Chem. 44, 695 (1980). 11. Duksin, D. and Mahoney, W.C., Relationship of the structure and biological activity
Data Sheet - SAB4200816
508 (1989). 6. Wang, Y. et al., Cancer Science., 99, 1100-108 (2008). 7. Nishio, H. et al., Biochem. Biophys. Res. Comm., 182, 34-8 (1992). 8. Rusnak, F., and Mertz, P., Physiol Rev., 80, 1483
Product Information Sheet - O8801
• Molecular weight 126.93 • Purity 99% (with practically no heavy metal impurities) • Color Colorless • Boiling point 63-64° • Melting point -10 to -8° • Specific gravity 1.455 • Refractive
XP725 Antibody Number-Lot Number 071M4826
736 757 758 759 760 8.5 689 690 691 692 713 714 715 716 737 738 739 740 761 762 763 764 8.6 693 694 695 696 717 718 719 720 741 742 743 744 765 766 767 768
Product Information Sheet-11699709001
kits ATP Bioluminescence Assay Kit CLS II 1 kit, 1,600 microplate assays, 800 tube assays   11 699 695 001 1 2 3 1 2 3 https://www.sigmaaldrich.com Pa pe r
Glycobiology Brochure
Spain Free Tel: 900 101 376 Free Fax: 900 102 028 Tel: (+34) 91 661 99 77 Fax: (+34) 91 661 96 42 Sweden Tel: (+46) 8 742 4200 Fax: (+46) 8 742 4243 Switzerland Free Tel: 0800 80 00 80 Free Fax: 0800
Product Information Sheet - INHIB1
University Press (Oxford, UK), p. 105-130 (2001). 10. Umezawa, H., Methods Enzymol., 45, 678-695 (1976). 11. Zollner, H., Handbook of Enzyme Inhibitors (2 nd edition), Part A, p. 94 (1993
Halal Certificate
President This certificate is valid until July 31, 2025 and subject to renewal at that time. Page 8 of 99 Product Name Product Code Halal-ID Product Certificate # 93. 2-AMINOACETOPHENONE
Halal Certificate
President This certificate is valid until July 31, 2023 and subject to renewal at that time. Page 8 of 99 Product Name Product Code Halal-ID Product Certificate # 93. 2-AMINOACETOPHENONE
Solvents Catalog
1.04200.0009 10 ml GA 13.60 1.04200.0010 Diethylether-D10 99 % D > 99 – – 0.78 1 ml GA 1.00 8.15031.0001 Dimethylacetamide-D9 99 % D > 99 – – 1.03 1 ml GA 1.03 8.15032.0001 Dimethylformamide-D7 99.5
Calbiochem Biologics 29.2
Aβ peptides. Reacts with a variety of species. Ref.: 1. Barelli, H., et al. 1997. Mol. Med. 3, 695 * EIA: enzyme immunoassay; ELISA: enzyme-linked immunosorbent assay; IB: immunoblotting; IF: immunofluorescence
XP725 Antibody List Lot 129K4831
BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/
XP725 Antibody List Lot 129K4830
BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/
XP725 Antibody List Lot 089K4791
BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/
Organic and Molecular Electronics
Nippon Kogyo Shinbun (7) Tessler, N.; Denton, G. J.; Friend, R. H. Nature 1996, 382, 695-697. (8) Frolov, S. V.; Ozaki, M.; Gellermann, W.; Vardeny, Z. V.; Yoshino, K. Jpn. J. Appl.
The Active Siteル Volume 4, Number 1
peptides. Suitable for IB, IP, PS. Cat. No. PC729 25 µl Ref.: Barelli, H., et al. 1997. Mol. Med. 3, 695. Indirect immunoperoxidase labeling of normal colon (A) and colon carcinoma (B) with Anti-5-methylcyto
XP725 Antibody List
SMARCA4,Smarca4 NP_003063.2,NP_035547.2 P y n/d n/d 79 BTK, C-Terminal B0811 695 BTK NP_000052.1 P y n/d n/d 80 BTK, N-Terminal B0686 695 BTK NP_000052.1 P y n/d n/d 81 BUB1 B0561 699 BUB1 NP_004327.1 M y n/d
XP725 Antibody List 013M4793
SMARCA4,Smarca4 NP_003063.2,NP_035547.2 P y n/d n/d 79 BTK, C-Terminal B0811 695 BTK NP_000052.1 P y n/d n/d 80 BTK, N-Terminal B0686 695 BTK NP_000052.1 P y n/d n/d 81 BUB1 B0561 699 BUB1 NP_004327.1 M y n/d
Imprint Ultra Chromatin Immunoprecipitation Kit User Guide
Primer Sequence Genomic position (hg18) Amplicon size (bp) Actin FP 5' AGTGTGGTCCTGCGACTTCTAAG 3' -695 to -619 chr7:5537367-5537443 77Actin RP 5' CCTGGGCTTGAGAGGTAGAGTGT 3' ZNF333-3’ FP 5’ TGCAGCCAGTGTGGGAAAGC
List of Antibodies
692 Survivin S8191 P y n/d n/d 693 Synaptotagmin S2177 P y y n/d 694 Synaptopodin S9442 P n/d n/d y 695 Synaptopodin S9567 P n/d n/d y 696 Anti Cy3+Cy5 C0992 M NA NA NA 697 SynCAM S4945 P n/d y y 698 α1
XP725 Worksheet for Lot Number 071M4826
www.sigmaaldrich.com/ProductLookup.html?ProdNo=H7412&Brand=SIGMA� p 695 4 3 3 7 Heat Shock Protein 110 H7287 696 4 3 3 8 Heat Shock Protein 110 H7287 697 4 3 4 1 Acetyl Histone H3 AcLys9 H9286 698