Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU114551

Sigma-Aldrich

MISSION® esiRNA

targeting human APOBEC3B

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGAAAACGAACCCATCCTCTATGGTCGGAGCTACACTTGGCTGTGCTATGAAGTGAAAATAAAGAGGGGCCGCTCAAATCTCCTTTGGGACACAGGGGTCTTTCGAGGCCAGGTGTATTTCAAGCCTCAGTACCACGCAGAAATGTGCTTCCTCTCTTGGTTCTGTGGCAACCAGCTGCCTGCTTACAAGTGTTTCCAGATCACCTGGTTTGTATCCTGGACCCCCTGCCCGGACTGTGTGGCGAAGCTGGCCGAATTCCTGTCTGAGCACCCCAATGTCACCCTGACCATCTCTGCCGCCCGCCTCTACTACTACTGGGAAAGAGATTACCGAAGGGCGCTCTGCAGGCTGAGTCAGGCAGGAGCCCGCGTGACGATCATGGACTATGAAGAATTTGCATACTGCTGGGAAAACTTTGTGTACAATGAAGGTCAGCAATTCATGC

Ensembl | human accession no.

ENSG00000179750

NCBI accession no.

NM_004900

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... APOBEC3B(9582) , APOBEC3B(9582)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Min Gwak et al.
Tumori, 100(4), 112e-117e (2014-10-10)
APOBEC3B is a deaminase that possesses DNA C-to-T editing activity. A recent report showed that APOBEC3B mRNA was overexpressed in breast cancer and that its expression was responsible for the high C-to-T mutation spectrum in breast cancer, suggesting that APOBEC3B
Qiu-Ping Jia et al.
Cancer chemotherapy and pharmacology, 83(4), 625-637 (2019-01-12)
Compelling evidence establishes the etiological role of viral proteins E6 and E7 of high-risk human papillomaviruses (HPV) in cervical carcinogenesis, but their contribution in chemoresistance that leads to advanced metastatic lesions remains poorly defined. Since metastasis-associated protein 1 (MTA1) upregulation
Zhe Jin et al.
Oncology reports, 32(5), 1867-1872 (2014-09-02)
Chondrosarcomas rank as the third most common type of bone tumors. In the present study, we demonstrated that expression of the apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) was higher in cancer tissues when compared to that in normal tissues. In
Yanmeng Chen et al.
Antiviral research, 149, 16-25 (2017-11-14)
Hepatitis B virus is a partially double-stranded DNA virus that replicates by reverse transcription, which occurs within viral core particles in the cytoplasm. The cytidine deaminase APOBEC3B is a cellular restriction factor for HBV. Recently, it was reported that APOBEC3B
Jian Zhang et al.
International journal of clinical and experimental pathology, 8(5), 5089-5096 (2015-07-21)
Gastric cancer was the third cause of death in China. In this study, we found that the APOBEC3 (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3) expression was higher in gastric cancer tissues than that in normal tissues and confirmed APOBEC3B

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service