Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU146741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAPDH

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Annalucia Carbone et al.
Stem cells international, 2018, 1203717-1203717 (2018-03-14)
We previously found that human amniotic mesenchymal stem cells (hAMSCs) in coculture with CF immortalised airway epithelial cells (CFBE41o- line, CFBE) on Transwell® filters acquired an epithelial phenotype and led to the expression of a mature and functional CFTR protein.
Suzan Ruijtenberg et al.
Nature structural & molecular biology, 27(9), 790-801 (2020-07-15)
Small interfering RNAs (siRNAs) promote RNA degradation in a variety of processes and have important clinical applications. siRNAs direct cleavage of target RNAs by guiding Argonaute2 (AGO2) to its target site. Target site accessibility is critical for AGO2-target interactions, but
R G Morgan et al.
Scientific reports, 8(1), 7952-7952 (2018-05-23)
3D tissue culture provides a physiologically relevant and genetically tractable system for studying normal and malignant human tissues. Despite this, gene-silencing studies using siRNA has proved difficult. In this study, we have identified a cause for why traditional siRNA transfection
Martin G Nussbaumer et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 3(10), 1600046-1600046 (2016-11-15)
The group II chaperonin thermosome (THS) is a hollow protein nanoparticle that can encapsulate macromolecular guests. Two large pores grant access to the interior of the protein cage. Poly(amidoamine) (PAMAM) is conjugated into THS to act as an anchor for
Wanwen Lan et al.
FEBS letters, 592(7), 1173-1184 (2018-03-08)
Long intergenic noncoding RNAs (lincRNAs) are not fully characterized in disease, although many are involved in controlling differentiation. We discovered and sequenced a novel 4.4 kb human lincRNA called linc-9432 in pterygium, an ocular disease characterized by a wedge lesion.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service