Skip to Content
Merck
All Photos(1)

Key Documents

EHU131051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDX58

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTGGAGGAACTGGAGCAAGTTGTTTATAAGCCCCAGAAGTTTTTCAGGAAAGTGGAATCACGGATTAGCGACAAATTTAAATACATCATAGCTCAGCTGATGAGGGACACAGAGAGTCTGGCAAAGAGAATCTGCAAAGACCTCGAAAACTTATCTCAAATTCAAAATAGGGAATTTGGAACACAGAAATATGAACAATGGATTGTTACAGTTCAGAAAGCATGCATGGTGTTCCAGATGCCAGACAAAGATGAAGAGAGCAGGATTTGTAAAGCCCTGTTTTTATACACTTCACATTTGCGGAAATATAATGATGCCCTCATTATCAGTGAGCATGCACGAATGAAAGATGCTCTGGATTACTTGAAAGACTTCTTCAGCAATGTCCGAGCAGCAGGATTCGATGAGATTGAGCAAGATCTTACTCAGAGATTTGAAGAAAAGCTGCAGGAACTAGAAAGTGTTTCCAGGGATCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming Zhong et al.
BMC cancer, 19(1), 439-439 (2019-05-16)
Dendritic cells (DCs) alter their role from being immunostimulatory to immunosuppressive at advanced stages of tumor progression, but the influence of cancer stem cells (CSCs) and their secreted factors on generation and phenotypic change of DCs is unknown. Retinoic acid-inducible
Ting He et al.
Life sciences, 231, 116570-116570 (2019-06-18)
Systemic inflammation is a main hallmark of chronic kidney disease (CKD), but the underlying mechanisms of pathogenesis of CKD-associated systemic inflammation is unclear. Current study was designed to investigate the relationship between indoxyl sulphate (IS) and CKD-associated systemic inflammation along
Lei Li et al.
Neuroscience letters, 672, 46-52 (2018-02-24)
The retinoic acid-inducible gene I (RIG-I) is a crucial cytoplasmic pathogen recognition receptor involved in neuroinflammation in degenerative diseases. In the present study, in vitro human astrocytes were subjected to a chemical hypoxia model using cobalt chloride pretreatment. Chemical hypoxia
Luciano Castiello et al.
Cancer immunology, immunotherapy : CII, 68(9), 1479-1492 (2019-08-30)
RIG-I is a cytosolic RNA sensor that recognizes short 5' triphosphate RNA, commonly generated during virus infection. Upon activation, RIG-I initiates antiviral immunity, and in some circumstances, induces cell death. Because of this dual capacity, RIG-I has emerged as a
Joon H Choi et al.
Genes & development, 34(23-24), 1697-1712 (2020-11-14)
Deciphering the mechanisms that regulate the sensitivity of pathogen recognition receptors is imperative to understanding infection and inflammation. Here we demonstrate that the RNA triphosphatase dual-specificity phosphatase 11 (DUSP11) acts on both host and virus-derived 5'-triphosphate RNAs rendering them less

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service