Skip to Content
Merck
All Photos(2)

Key Documents

EHU051011

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Tomonori Higuchi et al.
Scientific reports, 7(1), 11026-11026 (2017-09-10)
The genetic events that lead to aggressive transformation of cases of splenic marginal zone lymphoma (SMZL) after the chronic clinical stage have not been well understood. We aimed to find candidate genes associated with aggressive features of SMZL. We have
Owen Addis Jones et al.
Nature communications, 10(1), 2861-2861 (2019-06-30)
Centromeres provide a pivotal function for faithful chromosome segregation. They serve as a foundation for the assembly of the kinetochore complex and spindle connection, which is essential for chromosome biorientation. Cells lacking Polo-like kinase 1 (PLK1) activity suffer severe chromosome alignment
Yih-Gang Goan et al.
Cancers, 11(8) (2019-08-08)
Oral squamous cell carcinoma (OSCC) is one of the major leading causes of cancer-related death worldwide, with limited effective markers for diagnosis and therapy, which has caused a low overall survival rate in the past decades. Kinases play important roles
James C Evans et al.
Molecular pharmaceutics, 14(1), 42-52 (2017-01-04)
In recent years, RNA interference (RNAi) has emerged as a potential therapeutic offering the opportunity to treat a wide range of diseases, including prostate cancer. Modified cyclodextrins have emerged as effective gene delivery vectors in a range of disease models.

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service