Skip to Content
Merck
All Photos(1)

Key Documents

EMU025381

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fos

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAGTCAGAGAAGGCAAGGCAGCCGGCATCCAGACGTGCCACTGCCCGAGCTGGTGCATTACAGAGAGGAGAAACACGTCTTCCCTCGAAGGTTCCCGTCGACCTAGGGAGGACCTTACCTGTTCGTGAAACACACCAGGCTGTGGGCCTCAAGGACTTGCAAGCATCCACATCTGGCCTCCAGTCCTCACCTCTTCCAGAGATGTAGCAAAAACAAAACAAAACAAAACAAAAAACCGCATGGAGTGTGTTGTTCCTAGTGACACCTGAGAGCTGGTAGTTAGTAGAGCATGTGAGTCAAGGCCTGGTCTGTGTCTCTTTTCTCTTTCTCCTTAGTTTTCTCATAGCACTAACTAATCTGTTGGGTTCATTATTGGAATTAACCTGGTGCTGGATTGTATCTAGTGCAGCTGATTTTAACAATACCTACTGTGTTCCTGGCAATAGCGTGTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ji Hye Kim et al.
Stem cells and development, 23(12), 1364-1376 (2014-02-15)
Although adipose-derived stem cells (ASCs) show promise for cell therapy, there is a tremendous need for developing ASC activators. In the present study, we investigated whether or not vitamin C increases the survival, proliferation, and hair-regenerative potential of ASCs. In
Ryeojin Ko et al.
Nature communications, 6, 6765-6765 (2015-04-02)
TRAF6 is critical for the production of inflammatory cytokines in various TLR-mediated signalling pathways. However, it is poorly understood how TRAF6 regulates TLR3 responses. Here we demonstrate that GSK3β interacts with TRAF6 and positively regulates the TLR3-mediated signalling. Suppression of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service