Skip to Content
Merck
All Photos(1)

Key Documents

EHU109061

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACTAAGGCCAGACCCAAACTTTGATGCACTCATCAGCAAAATTTATCCAAGTCGTGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCCAGGATCAACAAGCACAATAATCAGCAAGCACTCAGTCACAGCATTGAGGAAGGACTGAAGATACAGGCCATGAACAGACTGCAGCGAGGCAAGAAACAACAGATTGAAAATGGTAGTGGAGCAGAAGATAATGGTGACAGTTCACACTGCAGTAATGCATCCACACATAGCAATCAGGAAGCAGGCCCTAGTAACAAACGGACCAAAACATCTGATGATTCTGGGCTAGAGCTTGATAATAACAATGCAGCAATGGCAATTGATCCAGTAATGGATGGTGCTAGTGAAATTGAATTAGTATTCAGGCCTCATCCCACACTTATGGAAAAAGATGACAGTGCACAGACGAGATACATAAAGACTTCTGGTAACGCCACTGTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feilong Wei et al.
Aging, 12(24), 26199-26220 (2020-12-22)
Ring finger protein 2 (RNF2) is an important component of polycomb repressive complex 1. RNF2 is upregulated in many kinds of tumors, and elevated RNF2 expression is associated with a poor prognosis in certain cancers. To assess the function of
Brandon S Sheffield et al.
The American journal of surgical pathology, 39(7), 977-982 (2015-01-31)
A variety of immunohistochemical (IHC) stains have been proposed to mark either benign or malignant mesothelial proliferations. Loss of the p16 tumor suppressor (CDKN2A), through homozygous deletions of 9p21, is a good marker of mesotheliomas but lacks sensitivity. Recent reports
Sen Zhu et al.
Nature communications, 9(1), 500-500 (2018-02-07)
BMI1, a polycomb group (PcG) protein, plays a critical role in epigenetic regulation of cell differentiation and proliferation, and cancer stem cell self-renewal. BMI1 is upregulated in multiple types of cancer, including prostate cancer. As a key component of polycomb

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service