Skip to Content
Merck
All Photos(1)

Key Documents

EHU124231

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATC

Ensembl | human accession no.

ENSG00000159216

NCBI accession no.

NM_001001890

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RUNX1(861) , RUNX1(861)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chenghao Lu et al.
Pathology, research and practice, 216(11), 153142-153142 (2020-09-01)
Colorectal cancer (CRC) was one of the most malignant tumors worldwide due to its metastasis. Epithelial-to-mesenchymal transition (EMT) plays an important role in CRC migration, and transforming growth factor-β (TGF-β) works as a dominating cytokine in CRC EMT process. Here
Tong Zhou et al.
EBioMedicine, 31, 217-225 (2018-05-16)
Renal fibrosis is widely considered a common mechanism leading to end-stage renal failure. Epithelial-to-mesenchymal transition (EMT) plays important roles in the pathogenesis of renal fibrosis. Runt-related transcription factor 1(RUNX1) plays a vital role in hematopoiesis via Endothelial-to-Hematopoietic Transition (EHT), a
AHyun Choi et al.
Blood, 130(15), 1722-1733 (2017-08-10)
The gene encoding the RUNX1 transcription factor is mutated in a subset of T-cell acute lymphoblastic leukemia (T-ALL) patients, and RUNX1 mutations are associated with a poor prognosis. These mutations cluster in the DNA-binding Runt domain and are thought to
Siyuan Zhou et al.
Biochemical and biophysical research communications, 519(3), 620-625 (2019-09-22)
Renal tubular epithelial cells (RTECs) play pivotal roles in the innate immune response in kidneys. Dendritic cell specific intracellular adhesion molecule-3 grabbing nonintegrin (DC-SIGN) functions as both the innate immune recognition receptor and the adhesion molecule. In our previous study
Tian Gao et al.
Cancer biology & medicine, 17(2), 371-386 (2020-06-27)
Objective: Osteosarcoma is a common primary highly malignant bone tumor. Kinesin family member 18B (KIF18B) has been identified as a potential oncogene involved in the development and metastasis of several cancer types. While KIF18B overexpression in osteosarcoma tissue is clearly
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service