Skip to Content
Merck
All Photos(1)

Key Documents

EHU019521

Sigma-Aldrich

MISSION® esiRNA

targeting human MAOA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGGAACGGAAGTTTGTAGGTGGATCTGGTCAAGTGAGCGAACGGATAATGGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTGACCAGTCAAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTATGAGTGCAAATACGTAATTAATGCGATCCCTCCGACCTTGACTGCCAAGATTCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTAATTCAGCGGCTTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTCTGGAAGAAGAAGGATTACTGTGGCTGCATGATCATTGAAGATGAAGATGCTCCAATTTCAATAACCTTGGATGACACCAAGCCAGATGGGTCACTGCCTGCCATCATGGGCTTCATTCTTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Soni Deshwal et al.
Cell death and differentiation, 25(9), 1671-1685 (2018-02-21)
Monoamine oxidase (MAO) inhibitors ameliorate contractile function in diabetic animals, but the mechanisms remain unknown. Equally elusive is the interplay between the cardiomyocyte alterations induced by hyperglycemia and the accompanying inflammation. Here we show that exposure of primary cardiomyocytes to
Salvatore Antonucci et al.
Antioxidants & redox signaling, 34(7), 531-550 (2020-06-12)
Aims: Doxorubicin cardiomyopathy is a lethal pathology characterized by oxidative stress, mitochondrial dysfunction, and contractile impairment, leading to cell death. Although extensive research has been done to understand the pathophysiology of doxorubicin cardiomyopathy, no effective treatments are available. We investigated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service