Skip to Content
Merck
All Photos(1)

Key Documents

EHU136181

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP2K7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGCTTTGGGACGTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCTGAGAAGCTCAAGAAGCGGATGCAGGGCCCCATCCCCGAGCGCATTCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGGTGTCATCCACCGCGACGTCAAGCCCTCCAACATCCTGCTGGACGAGCGGGGCCAGATCAAGCTCTGCGACTTCGGCATCAGCGGCCGCCTGGTGGACTCCAAAGCCAAGACGCGGAGCGCCGGCTGTGCCGCCTACATGGCACCCGAGCGCATTGACCCCCCAGACCCCACCAAGCCGGACTATGACATCCGGGCCGACGTATGGAGCCTGGGCATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTACAAGAACTGCAAGACGGACTTTGAGGTCCTCACCAAAGTCCTACAGGAAGAGCCCCCGCTTCTGCCCGGACACATGGGCTTCTCGGGGGACTTCCAGTCCTTCGTCAAAGACTGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Junxia Cao et al.
Theranostics, 9(3), 811-828 (2019-02-28)
Targeting cancer stem cells (CSCs) has been proposed as a new strategy to eradicate malignancies, including hepatocellular carcinoma (HCC). However, the mechanisms by which CSCs sustain their self-renewal and chemoresistance remain elusive. Nanog is a master transcriptional regulator of stemness
Marianna Lucafò et al.
Cancer chemotherapy and pharmacology, 86(3), 361-374 (2020-08-11)
Glucocorticoids (GCs) are commonly used as therapeutic agents for immune-mediated diseases and leukemia. However, considerable inter-individual differences in efficacy have been reported. Several reports indicate that the inhibitor of mTOR rapamycin can reverse GC resistance, but the molecular mechanism involved

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service