콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU002721

Sigma-Aldrich

MISSION® esiRNA

targeting human ERN1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CACAGTGACGCTTCCTGAAACCTTGTTGTTTGTGTCAACGCTGGATGGAAGTTTGCATGCTGTCAGCAAGAGGACAGGCTCAATCAAATGGACTTTAAAAGAAGATCCAGTCCTGCAGGTCCCAACACATGTGGAAGAGCCTGCCTTTCTCCCAGATCCTAATGATGGCAGCCTGTATACGCTTGGAAGCAAGAATAATGAAGGCCTGACGAAACTTCCTTTTACCATCCCAGAATTGGTGCAGGCATCCCCATGCCGAAGTTCAGATGGAATCCTCTACATGGGTAAAAAGCAGGACATCTGGTATGTTATTGACCTCCTGACCGGAGAGAAGCAGCAGACTTTGTCATCGGCCTTTGCAGATAGTCTCTGCCCATCAACCTCTCTTCTGTATCTTGGGCGAACAGAATACACCATCACCATGTACGACACCAAAACCCGAGAGCTCCGGTGGAATGCCACCTACTTTGACTATGCGGCCTCACTGCCTGAGGACGACGTGGACTACAAGATGTCCCACTTTGTGTCCAATGGTGATGGGCTGGTGGTGACTGTGGACAGT

Ensembl | 인체 수납 번호

ENSG00000178607

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ERN1(2081) , ERN1(2081)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Anne-Sophie Michallet et al.
PloS one, 6(10), e25820-e25820 (2011-10-27)
To determine whether the Unfolded Protein Response (UPR) sensors (PERK, ATF6 and IRE-1) can be targeted to promote death of Multiple Myeloma (MM) cells. We have knocked-down separately each UPR stress sensor in human MM cell lines using RNA interference
Antonello Storniolo et al.
Oxidative medicine and cellular longevity, 2015, 645157-645157 (2015-04-30)
Relative to their normal counterparts, tumor cells generally exhibit a greater "stress phenotype" and express heat shock proteins (Hsp) that represent candidate targets for anticancer therapy. Here we investigated the role of Hsp70 in survival induced by endoplasmic reticulum (ER)
Xiaoli Hu et al.
Cancer cell international, 20, 250-250 (2020-06-23)
Acute myeloid leukemia (AML) patients with FMS-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) have a high relapse rate and poor prognosis. This study aims to explore the underlying mechanism of combining Gilteritinib with ATO at low concentration in the treatment
Qun Lai et al.
Yonsei medical journal, 54(6), 1407-1415 (2013-10-22)
To investigate the anti-apoptotic mechanism of leptin in non-small cell lung cancer. The influences of leptin on apoptosis were investigated, analyzing the mechanism that triggers growth of A549 cells. The effects of leptin on cell proliferation were examined by XTT
Xia Sheng et al.
EMBO molecular medicine, 7(6), 788-801 (2015-04-13)
The unfolded protein response (UPR) is a homeostatic mechanism to maintain endoplasmic reticulum (ER) function. The UPR is activated by various physiological conditions as well as in disease states, such as cancer. As androgens regulate secretion and development of the
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.