콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU015291

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM7

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCATCTACCGAAGACACTCATGAAGTAGATTCCAAAGCAGCTTTAATACCGGATTGGTTACAAGATAGACCATCAAACAGAGAAATGCCATCTGAAGAAGGAACATTAAATGGTCTCACTTCTCCATTTAAGCCAGCTATGGATACAAATTACTATTATTCAGCTGTGGAAAGAAATAACTTGATGAGGTTATCACAGAGCATTCCATTTACACCTGTGCCTCCAAGAGGGGAGCCTGTCACAGTGTATCGTTTGGAAGAGAGTTCACCCAACATACTAAATAACAGCATGTCTTCTTGGTCACAACTAGGCCTCTGTGCCAAAATAGAGTTTTTAAGCAAAGAGGAGATGGGAGGAGGTTTACGAAGAGCTGTCAAAGTACAGTGTACCTGGTCAGAACATGATATCCTCAAATCAGGGCATCTT

Ensembl | 인체 수납 번호

ENSG00000092439

NCBI 수납 번호

NM_017672

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TRPM7(54822) , TRPM7(54822)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
CBV
WZU
QCS
KLS
NRR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hong-Liang Xu et al.
Neurochemistry international, 112, 197-205 (2017-07-25)
Neuronal death after traumatic brain injury (TBI) is a complex process resulting from a combination of factors, many of which are still unknown. Transient receptor potential melastatin 7 (TRPM7) is a transient receptor potential channel that has been demonstrated to
Xiuzhi Zhang et al.
Acta biomaterialia, 63, 369-382 (2017-09-09)
Mg-based alloys, as the potential orthopaedic implant, can self-degrade to avoid second operation for its remove, and enable to promote bone repair; however, the underlying molecular mechanisms remain unclear. In the present study, we examined the effect of Mg ions
Yuqiang Liu et al.
Cell reports, 23(12), 3480-3491 (2018-06-21)
The TRPM7 chanzyme contributes to several biological and pathological processes in different tissues. However, its role in the CNS under physiological conditions remains unclear. Here, we show that TRPM7 knockdown in hippocampal neurons reduces structural synapse density. The synapse density
Constantin Römmelt et al.
Journal of biomedical materials research. Part B, Applied biomaterials, 107(6), 1806-1813 (2018-12-07)
The reasons for the high number of loosened metal-on-metal (MoM) hip implants are still not fully understood. Hypoxia-inducible factor 1 (HIF-1) mediated signaling pathways, which normally modulate tissue metabolism under hypoxic circumstances, could be triggered by metallic wear debris and
Mingyang Yu et al.
Molecular medicine reports, 22(4), 2741-2752 (2020-09-19)
Gallium (Ga) ions have been widely utilized for biomedical applications; however, their role in osteoblast regulation is not completely understood. The aim of the present study was to investigate the potential effect of Ga ions on osteoinduction in two osteoblast cell
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.