콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU017941

Sigma-Aldrich

MISSION® esiRNA

targeting human FPR2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTTTTGGCTGGTTCCTGTGTAAGTTAATTCACATCGTGGTGGACATCAACCTCTTTGGAAGTGTCTTCTTGATTGGTTTCATTGCACTGGACCGCTGCATTTGTGTCCTGCATCCAGTCTGGGCCCAGAACCACCGCACTGTGAGTCTGGCCATGAAGGTGATCGTCGGACCTTGGATTCTTGCTCTAGTCCTTACCTTGCCAGTTTTCCTCTTTTTGACTACAGTAACTATTCCAAATGGGGACACATACTGTACTTTCAACTTTGCATCCTGGGGTGGCACCCCTGAGGAGAGGCTGAAGGTGGCCATTACCATGCTGACAGCCAGAGGGATTATCCGGTTTGTCATTGGCTTTAGCTTGCCGATGTCCATTGTTGCCATCTGCTATGGGCTCATTGCAGCCAAGATCCACAAAAAGGGCATGATTAAATCCAGCCGTCCCTTACGGGTCCTCACTGCTGTGGTGGCTTCTTTCTTCATCTGTTGGTTTCCCTTTCAACTGG

Ensembl | 인체 수납 번호

ENSG00000171049

NCBI 수납 번호

NM_001005738
NM_001462

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FPR2(2358) , FPR2(2358)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Liang Zong et al.
Journal of experimental & clinical cancer research : CR, 36(1), 181-181 (2017-12-13)
Pancreatic cancer is a lethal disease in part because of its potential for aggressive invasion and metastasis. Lipoxin A4 (LXA4) is one of the metabolites that is derived from arachidonic acid and that is catalyzed by 15-lipoxygenase (15-LOX), and it
Yi Xiang et al.
American journal of cancer research, 6(11), 2599-2610 (2016-12-03)
The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human
Maayan Pereg et al.
PloS one, 14(6), e0217681-e0217681 (2019-06-07)
The ability to efficiently perform actions immediately following instructions and without prior practice has previously been termed Rapid Instructed Task Learning (RITL). In addition, it was found that instructions are so powerful that they can produce automatic effects, reflected in
Shixun Wang et al.
BioMed research international, 2016, 4819327-4819327 (2016-03-24)
Visfatin has been reported to exert an important role in the development of atherosclerosis. However, the mechanism that regulated the expression of Visfatin has not been elucidated yet. This study aimed to investigate the effect of SAA on the regulation
Padma Murthi et al.
Cells, 9(4) (2020-04-16)
We reported earlier that an anti-inflammatory small peptide receptor-formyl peptide receptor-2 (FPR2) was significantly decreased in placentas from third trimester pregnancies complicated with fetal growth restriction (FGR), compared to placentas from uncomplicated control pregnancies, suggesting FPR2 may play a role
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.