콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU020611

Sigma-Aldrich

MISSION® esiRNA

targeting human MUS81

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGTCGGTGCGAGAAGTGTTTGCCCGGCAGCTGATGCAGGTGCGCGGAGTGAGTGGGGAGAAGGCAGCAGCCCTGGTGGATCGATACAGCACCCCTGCCAGCCTCCTGGCCGCCTATGATGCCTGTGCCACCCCCAAGGAACAAGAGACACTGCTGAGCACCATTAAGTGTGGGCGTCTACAGAGGAATCTGGGGCCTGCTCTGAGCAGGACCTTATCCCAGCTCTACTGCAGCTACGGCCCCTTGACCTGAGCTTATGCCGTGAAACAGCCCCCAGCCCCCGTCTGTCCCCCAACCCAGGCTAGCCAGCCTTTTAACAACATCTTTTGGGGTACAATTAGAATCTAAGTGTTTGCAGCCATATGTGTCATGTAGAAGATGCCTAGCCCTGGGGACCTTGTGAAATACGCAGGAACCAGGGATAC

Ensembl | 인체 수납 번호

ENSG00000172732

NCBI 수납 번호

NM_025128

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MUS81(80198) , MUS81(80198)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ACIU
QCS
DQS
HRX
HXR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ying Wai Chan et al.
Nature communications, 5, 4844-4844 (2014-09-12)
Holliday junction (HJ) resolvases are necessary for the processing of persistent recombination intermediates before cell division. Their actions, however, need to be restricted to the late stages of the cell cycle to avoid the inappropriate cleavage of replication intermediates. Control
Delphine Lemaçon et al.
Nature communications, 8(1), 860-860 (2017-10-19)
The breast cancer susceptibility proteins BRCA1 and BRCA2 have emerged as key stabilizing factors for the maintenance of replication fork integrity following replication stress. In their absence, stalled replication forks are extensively degraded by the MRE11 nuclease, leading to chemotherapeutic
Yuping Yin et al.
Molecular cancer therapeutics, 18(8), 1439-1450 (2019-05-31)
DNA replication and repair proteins play an important role in cancer initiation and progression by affecting genomic instability. The DNA endonuclease Mus81 is a DNA structure-specific endonuclease, which has been implicated in DNA replication and repair. In this study, we
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).
Haiqing Fu et al.
Nature communications, 6, 6746-6746 (2015-04-17)
The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.