콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU030881

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF2AK3, AC104134.2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGGGGCACTCCTTTGAACTTTGTCCTTCTGAAGCTTCTCCTTATGTAAGGTCAAGGGAGAGAACCTCCTCTTCAATAGTATTTGAAGATTCTGGCTGTGATAATGCTTCCAGTAAAGAAGAGCCGAAAACTAATCGATTGCATATTGGCAACCATTGTGCTAATAAACTAACTGCTTTCAAGCCCACCAGTAGCAAATCTTCTTCTGAAGCTACATTGTCTATTTCTCCTCCAAGACCAACCACTTTAAGTTTAGATCTCACTAAAAACACCACAGAAAAACTCCAGCCCAGTTCACCAAAGGTGTATCTTTACATTCAAATGCAGCTGTGCAGAAAAGAAAACCTCAAAGACTGGATGAATGGACGATGTACCATAGAGGAGAGAGAGAGGAGCGTGTGTCTGCACATCTTCC

Ensembl | 인체 수납 번호

ENSG00000172071

NCBI 수납 번호

NM_004836

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... EIF2AK3(9451) , EIF2AK3(9451)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Palsamy Periyasamy et al.
Autophagy, 12(8), 1310-1329 (2016-06-24)
Cocaine is known to induce inflammation, thereby contributing in part, to the pathogenesis of neurodegeneration. A recent study from our lab has revealed a link between macroautophagy/autophagy and microglial activation. The current study was aimed at investigating whether cocaine could
Yanchun Gao et al.
International journal of biological sciences, 16(4), 543-552 (2020-02-07)
Vascular injury is considered an important pathological process during glucocorticoid (GC)-induced osteonecrosis of the femoral head (ONFH). In this study, we tried to investigate whether the endoplasmic reticulum (ER) stress is triggered in the GC-induced endotheliocyte (EC) apoptosis and ONFH.
Nicholas Catanzaro et al.
Virus research, 276, 197820-197820 (2019-11-20)
Replication of most RNA viruses is closely associated with the endoplasmic reticulum (ER) within permissive cells. As such, viruses often induce tremendous amounts of stress on cells during viral replication. To cope with the stress, cells initiate the unfolded protein
Qun Huang et al.
Molecular and cellular biochemistry, 431(1-2), 67-74 (2017-03-03)
Studies have demonstrated that the high-mobility group 1B protein (HMGB1) could regulate endothelial progenitor cell (EPC) homing, but the effect of HMGB1 on EPC apoptosis and associated mechanisms are still unclear. The aim of this study was to investigate the
Saiprasad Ramnarayanan et al.
Biology of reproduction, 95(6), 120-120 (2016-10-14)
There is considerable evidence that implicates oxidative stress in the pathophysiology of human pregnancy complications. However, the role and the mechanism of maintaining an antioxidant prosurvival uterine environment during normal pregnancy is largely unresolved. Herein we report that the highly
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.