콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU033921

Sigma-Aldrich

MISSION® esiRNA

targeting human TUFM

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaoyuan Weng et al.
Oncology letters, 20(5), 250-250 (2020-10-01)
Gastrointestinal stromal tumors (GISTs) are the most common pathologic type of mesenchymal tumor in the digestive tract. Patients with GIST face the risk of metastasis, postoperative recurrence and imatinib mesylate (IM) resistance. Mitochondrial Tu translation elongation factor (TUFM) is highly
Keiichi Tamai et al.
Scientific reports, 10(1), 21592-21592 (2020-12-11)
Cancer stem cells (CSCs) define a subpopulation of cancer cells that are resistant to therapy. However, little is known of how CSC characteristics are regulated. We previously showed that dormant cancer stem cells are enriched with a CD274low fraction of
Dasol Kim et al.
Communications biology, 4(1), 1-1 (2021-01-06)
Disorders of autophagy, a key regulator of cellular homeostasis, cause a number of human diseases. Due to the role of autophagy in metabolic dysregulation, there is a need to identify autophagy regulators as therapeutic targets. To address this need, we

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.