콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU035131

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACACATCAAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATTTTCATCAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTACCAGCTACTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTTAATGTTTCTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTGAAACAATTCCAGGGCAT

Ensembl | 인체 수납 번호

ENSG00000102554

NCBI 수납 번호

NM_001730

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KLF5(688) , KLF5(688)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
IEU
XBU
OSS
QCS
JRR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

P Chen et al.
European review for medical and pharmacological sciences, 24(8), 4224-4231 (2020-05-07)
This study aims to investigate the expression characteristics of Krüppel-like factor 5 (KLF5) in gastric cancer (GC) and its potential correlation to pathological indexes in GC patients. Molecular mechanisms underlying the regulatory effect of KLF5 on GC progression are explored.
Qiu-Yu Wang et al.
Molecular oncology, 14(9), 2203-2230 (2020-05-28)
Long noncoding RNAs (lncRNAs) have important regulatory roles in cancer biology. Although some lncRNAs have well-characterized functions, the vast majority of this class of molecules remains functionally uncharacterized. To systematically pinpoint functional lncRNAs, a computational approach was proposed for identification
Kaixin Wangzhou et al.
Frontiers in physiology, 11, 606967-606967 (2021-02-20)
Human periodontal ligament cells (hPDLCs) play a vital role in cell regeneration and tissue repair with multi-directional differentiation potential. microRNAs (miRs) are implicated in the osteogenesis of hPDLCs. This study explored the mechanism of miR-143-3p in osteogenesis of hPDLCs. Osteogenic
Yan-Yi Jiang et al.
Gastroenterology, 159(4), 1311-1327 (2020-07-04)
We investigated the transcriptome of esophageal squamous cell carcinoma (ESCC) cells, activity of gene regulatory (enhancer and promoter regions), and the effects of blocking epigenetic regulatory proteins. We performed chromatin immunoprecipitation sequencing with antibodies against H3K4me1, H3K4me3, and H3K27ac and
Yubo Liu et al.
Nature communications, 11(1), 5898-5898 (2020-11-21)
O-GlcNAc modification plays critical roles in regulating the stress response program and cellular homeostasis. However, systematic and multi-omics studies on the O-GlcNAc regulated mechanism have been limited. Here, comprehensive data are obtained by a chemical reporter-based method to survey O-GlcNAc
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.