설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CLTC(1213) , CLTC(1213)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Min Feng et al.
Virus research, 253, 12-19 (2018-05-29)
Bombyx mori nucleopolyhedrovirus (BmNPV) is a leading cause of silkworm mortality and economic loss to sericulture. The entry of BmNPV budded virus (BV) into host cells is a fundamental process required for the initiation of infection. However, our understanding of
Zhenzhu Jiang et al.
Anti-cancer drugs, 32(1), 1-10 (2020-09-16)
Circular RNAs are involved in the occurrence and development of different types of cancers. We aimed to illustrate the expression profile and mechanism of circ_0074027 in non-small cell lung cancer (NSCLC). Quantitative real-time PCR was employed to detect the expression
Jiao Liu et al.
Science signaling, 12(585) (2019-06-13)
Transient receptor potential vanilloid 1 (TRPV1), a nonselective, ligand-gated cation channel, responds to multiple noxious stimuli and is targeted by many kinases that influence its trafficking and activity. Studies on the internalization of TRPV1 have mainly focused on that induced
Lei Miao et al.
Nature communications, 11(1), 2424-2424 (2020-05-18)
Lipid-like nanoparticles (LNPs) have potential as non-viral delivery systems for mRNA therapies. However, repeated administrations of LNPs may lead to accumulation of delivery materials and associated toxicity. To address this challenge, we have developed biodegradable lipids which improve LNPs clearance
Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.