설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCAGCCCTCAAAAACAAGAGACCCAGAAAAGATGAAAACGAAAGTTCAGCCCCGGCTGACGGTGAGGGTGGCTCGGAACTGCAGCCCAAGAACAAGCGCATGACAATAAGCAGATTGGTCTTGGAGGAGGACAGCCAGAGTACTGAGCCCAGCGCAGGCCTCAACTCCTCCCAGGAGGCCGCTTCAGCGCCACCATCCAAGCCCACCGTTCTCAACCAACCCCTCCCTGGAGAGAAGAATCCCAAAGTACCCAAAGGCAAGTGGAACAGCTCTAATGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAGGCAGCACCAGATGAAGACAGTACAACCAATATAACAAAAAAGCAGAAGTGGACTGTAGAAGAAAGCGAGTGGGTCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TERF2(7014) , TERF2(7014)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Venkateswarlu Popuri et al.
Nucleic acids research, 42(9), 5671-5688 (2014-03-14)
A variety of human tumors employ alternative and recombination-mediated lengthening for telomere maintenance (ALT). Human RecQ helicases, such as BLM and WRN, can efficiently unwind alternate/secondary structures during telomere replication and/or recombination. Here, we report a novel role for RECQL1
Saara Hämälistö et al.
Nature communications, 11(1), 229-229 (2020-01-15)
Lysosomes are membrane-surrounded cytoplasmic organelles filled with a powerful cocktail of hydrolases. Besides degrading cellular constituents inside the lysosomal lumen, lysosomal hydrolases promote tissue remodeling when delivered to the extracellular space and cell death when released to the cytosol. Here
Deeksha Pal et al.
PloS one, 10(3), e0115651-e0115651 (2015-03-03)
Telomere binding factors viz. TRF1 and TRF2 are a part of sheltrin complex that are present exclusively at the ends of chromosomes. These factors play an important role in maintaining chromosomal integrity at the ends. However, their status and role
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.