콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU042991

Sigma-Aldrich

MISSION® esiRNA

targeting human TERF2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCAGCCCTCAAAAACAAGAGACCCAGAAAAGATGAAAACGAAAGTTCAGCCCCGGCTGACGGTGAGGGTGGCTCGGAACTGCAGCCCAAGAACAAGCGCATGACAATAAGCAGATTGGTCTTGGAGGAGGACAGCCAGAGTACTGAGCCCAGCGCAGGCCTCAACTCCTCCCAGGAGGCCGCTTCAGCGCCACCATCCAAGCCCACCGTTCTCAACCAACCCCTCCCTGGAGAGAAGAATCCCAAAGTACCCAAAGGCAAGTGGAACAGCTCTAATGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAGGCAGCACCAGATGAAGACAGTACAACCAATATAACAAAAAAGCAGAAGTGGACTGTAGAAGAAAGCGAGTGGGTCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Venkateswarlu Popuri et al.
Nucleic acids research, 42(9), 5671-5688 (2014-03-14)
A variety of human tumors employ alternative and recombination-mediated lengthening for telomere maintenance (ALT). Human RecQ helicases, such as BLM and WRN, can efficiently unwind alternate/secondary structures during telomere replication and/or recombination. Here, we report a novel role for RECQL1
Saara Hämälistö et al.
Nature communications, 11(1), 229-229 (2020-01-15)
Lysosomes are membrane-surrounded cytoplasmic organelles filled with a powerful cocktail of hydrolases. Besides degrading cellular constituents inside the lysosomal lumen, lysosomal hydrolases promote tissue remodeling when delivered to the extracellular space and cell death when released to the cytosol. Here
Deeksha Pal et al.
PloS one, 10(3), e0115651-e0115651 (2015-03-03)
Telomere binding factors viz. TRF1 and TRF2 are a part of sheltrin complex that are present exclusively at the ends of chromosomes. These factors play an important role in maintaining chromosomal integrity at the ends. However, their status and role

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.