콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU050101

Sigma-Aldrich

MISSION® esiRNA

targeting human PARP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CACTCATGCAACCACACACAATGCGTATGACTTGGAAGTCATCGATATCTTTAAGATAGAGCGTGAAGGCGAATGCCAGCGTTACAAGCCCTTTAAGCAGCTTCATAACCGAAGATTGCTGTGGCACGGGTCCAGGACCACCAACTTTGCTGGGATCCTGTCCCAGGGTCTTCGGATAGCCCCGCCTGAAGCGCCCGTGACAGGCTACATGTTTGGTAAAGGGATCTATTTCGCTGACATGGTCTCCAAGAGTGCCAACTACTGCCATACGTCTCAGGGAGACCCAATAGGCTTAATCCTGTTGGGAGAAGTTGCCCTTGGAAACATGTATGAACTGAAGCACGCTTCACATATCAGCAAGTTACCCAAGGGCAAGCACAGTGTCAAAGGTTTGGGCAAAAC

Ensembl | 인체 수납 번호

ENSG00000143799

NCBI 수납 번호

NM_001618

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PARP1(142) , PARP1(142)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhuoyu Gu et al.
Journal of hematology & oncology, 11(1), 115-115 (2018-09-16)
Recently, many potential prognostic biomarkers for gastric cancer (GC) have been identified, but the prognosis of advanced GC patients remains poor. Chloride channels are promising cancer biomarkers, and their family member chloride channel-3 (CLC-3) is involved in multiple biological behaviors.
Qianghua Xia et al.
Diabetologia, 59(11), 2360-2368 (2016-08-20)
One of the most strongly associated type 2 diabetes loci reported to date resides within the TCF7L2 gene. Previous studies point to the T allele of rs7903146 in intron 3 as the causal variant at this locus. We aimed to
Manish Mishra et al.
Biochimica et biophysica acta, 1863(7), 1761-1769 (2017-05-10)
In diabetes, matrix metalloproteinase-9 (MMP-9) is activated, which damages mitochondria, resulting in accelerated capillary cell apoptosis. Regulation of MMP-9 is controlled by multiple transcription factors including nuclear factor-kB (NF-kB) and activator protein-1 (AP-1). Binding of these transcription factors, however, can
Hogyoung Kim et al.
Journal of translational medicine, 13, 233-233 (2015-07-18)
We and others have extensively investigated the role of PARP-1 in cell growth and demise in response to pathophysiological cues. Most of the clinical trials on PARP inhibitors are targeting primarily estrogen receptor (ER) negative cancers with BRCA-deficiency. It is
Jian-Ning Zhang et al.
Mediators of inflammation, 2019, 3013716-3013716 (2020-02-23)
Sepsis is a leading cause of death in patients with severe infection worldwide. Remifentanil is an ultra-short-acting, potent opioid analgesic. In the study, we aimed to investigate the role and underlying mechanism of remifentanil in lipopolysaccharide- (LPS-) induced inflammation in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.