추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATACCTGCTCAGAGTGGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAGCCTGTGGATGCCGTCAAGCTGAACCTCCCTGATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAAAACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAATTGTTACATCTACAACAAGCCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATAAATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGACGTGGGAGGAAAGAAACA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... BRD4(23476) , BRD4(23476)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Zeynab Najafova et al.
Nucleic acids research, 45(1), 127-141 (2016-09-22)
Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we
Xuanchen Zhou et al.
Frontiers in medicine, 7, 413-413 (2020-09-15)
Objectives: This study aimed to explore the relationship between bromodomain-containing protein 4 (BRD4), epithelial-mesenchymal transition (EMT), and disease severity in chronic rhinosinusitis with nasal polyps (CRSwNP). Methods: We performed immunofluorescent (IF) staining to evaluate the expression of BRD4 in the
Stella Liong et al.
Reproduction (Cambridge, England), 155(6), 573-582 (2018-05-12)
Preeclampsia affects 5% of all pregnancies and is a serious disorder of pregnancy, characterised by high maternal blood pressure, placental hypoxia, fluid retention (oedema) and proteinuria. Women with preeclampsia are associated with exaggerated levels of pro-inflammatory cytokines, chemokines and anti-angiogenic
Yuki Takagawa et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 28(6), 1494-1505 (2020-04-23)
BRD4, a member of the bromodomain and extra-terminal domain (BET) protein family, plays a role in the organization of super-enhancers and transcriptional activation of oncogenes in cancer and is recognized as a promising target for cancer therapy. microRNAs (miRNAs), endogenous
Hong Zuo et al.
Biochimie, 165, 100-107 (2019-07-22)
High glucose (HG)-induced podocyte injury contributes to the pathogenesis of diabetic nephropathy, a severe complication of diabetes. Bromodomain-containing protein 4 (BRD4) has emerged as a critical regulator for cell injury. However, whether BRD4 participates in HG-induced podocyte injury remains unclear.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.