설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACAGGGTCTGAAGGACTGGATTGGCCAAACATCAGACCTGTCTTCCAAGGAGACCAAGTCCTGGCTACATCCCAGCCTGTGGTTACAGTGCAGACAGGCCATGTGAGCCACCGCTGCCAGCACAGAGCGTCCTTCCCCCTGTAGACTAGTGCCGTAGGGAGTACCTGCTGCCCCAGCTGACTGTGGCCCCCTCCGTGATCCATCCATCTCCAGGGAGCAAGACAGAGACGCAGGAATGGAAAGCGGAGTTCCTAACAGGATGAAAGTTCCCCCATCAGTTCCCCCAGTACCTCCAAGCAAGTAGCTTTCCACATTTGTCACAGAAATCAGAGGAGAGACGGTGTTGGGAGCCCTTTGGAGAACGCCAGTCTCCCAGGCCCCCTGCATCTATCGAGTTTGCAATGTCACAACCTCTCTGATCTTGTGCTCAGCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CTSB(1508) , CTSB(1508)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ana Mitrović et al.
European journal of cell biology, 96(6), 622-631 (2017-05-13)
Cathepsins B and X are lysosomal cysteine carboxypeptidases suggested as having a redundant role in cancer. They are involved in a number of processes leading to tumor progression but their role in the epithelial-mesenchymal transition (EMT) remains unknown. We have
Cathepsin B as a potential prognostic and therapeutic marker for human lung squamous cell carcinoma.
Fengming Gong et al.
Molecular cancer, 12(1), 125-125 (2013-10-22)
The lung squamous cell carcinoma survival rate is very poor despite multimodal treatment. It is urgent to discover novel candidate biomarkers for prognostic assessment and therapeutic targets to lung squamous cell carcinoma (SCC). Herein a two-dimensional gel electrophoresis and ESI-Q-TOF
Xin Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 107, 390-396 (2018-08-14)
Resistance to adjuvant radiotherapy is a major cause of treatment failure in patients with glioblastoma (GBM). Recently, the role of lysosome, especially lysosomal proteases, in radioresistance is being paid more and more attention to. Here, we investigated the radioresistant role
Man Kyu Shim et al.
Biomaterials, 261, 120347-120347 (2020-09-06)
Chemotherapy has shown remarkable therapeutic efficacy for various types of cancer. However, drug resistance reduces the effectiveness and sensitivity of chemotherapy, leading treatment failure and cancer relapse in many clinical indications. Herein, we propose cancer-specific drug-drug nanoparticles (DD-NPs) that improve
Man Kyu Shim et al.
Journal of controlled release : official journal of the Controlled Release Society, 294, 376-389 (2018-12-15)
Cancer nanomedicine using nanoparticle-based delivery systems has shown outstanding promise in recent decades for improving anticancer treatment. However, limited targeting efficiency, low drug loading efficiency and innate toxicity of nanoparticles have caused severe problems, leaving only a few available in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.