추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTCTTCTCCCGGGATGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTCTCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGATGACTTCCTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTGCCCTCACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGATGCCAAGTCTGCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTTACATGGTTATAGAGCCCTCAGGCAGACTGAATTCTAAATCTGTGAAGGATCTAAGGAGACACATGCACCGGAAATT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... YAP1(10413) , YAP1(10413)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xiaojian Zhu et al.
Journal of experimental & clinical cancer research : CR, 39(1), 207-207 (2020-10-08)
Accumulating evidence indicates that long non-coding RNAs (lncRNAs) acting as crucial regulators in tumorigenesis. However, its biological functions of lncRNAs in colorectal cancer (CRC) have not been systematically clarified. An unbiased screening was performed to identify disregulated lncRNAs revealed to
Marcel Trautmann et al.
EMBO molecular medicine, 11(5) (2019-03-23)
Myxoid liposarcomas (MLS), malignant tumors of adipocyte origin, are driven by the FUS-DDIT3 fusion gene encoding an aberrant transcription factor. The mechanisms whereby FUS-DDIT3 mediates sarcomagenesis are incompletely understood, and strategies to selectively target MLS cells remain elusive. Here we
Akira Takaguri et al.
European journal of pharmacology, 815, 470-477 (2017-09-28)
Apoptosis of vascular smooth muscle cells (VSMCs) has been implicated in the progression of atherosclerosis, especially in vascular remodelling and plaque rupture. Although it is known that Yes-associated protein 1 (YAP1) is a critical molecule that regulates cell proliferation, differentiation
Takahiro Tsuji et al.
Nature communications, 11(1), 74-74 (2020-01-05)
Despite the promising clinical efficacy of the second-generation anaplastic lymphoma kinase (ALK) inhibitor alectinib in patients with ALK-rearranged lung cancer, some tumor cells survive and eventually relapse, which may be an obstacle to achieving a cure. Limited information is currently available
Functional screening identifies miRNAs influencing apoptosis and proliferation in colorectal cancer.
Lise Lotte Christensen et al.
PloS one, 9(6), e96767-e96767 (2014-06-04)
MicroRNAs (miRNAs) play a critical role in many biological processes and are aberrantly expressed in human cancers. Particular miRNAs function either as tumor suppressors or oncogenes and appear to have diagnostic and prognostic significance. Although numerous miRNAs are dys-regulated in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.