콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU122051

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAACC

Ensembl | 인체 수납 번호

ENSG00000168610

NCBI 수납 번호

NM_003150

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... STAT3(6774) , STAT3(6774)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jong Hyun Lee et al.
Journal of advanced research, 26, 83-94 (2020-11-03)
Epithelial-mesenchymal transition (EMT) is a process of transdifferentiation where epithelial cells attain mesenchymal phenotype to gain invasive properties and thus, can contribute to metastasis of tumor cells. The antimetastatic and antitumor efficacy of brusatol (BT) was investigated in a hepatocellular
Chengyang Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 743-756 (2017-09-28)
To evaluate the effect of Liuweibuqi capsules on chronic obstructive pulmonary disease (COPD) through the JAK/STAT pathway. Lung function was measured with a spirometer. Changes in lung histology were observed using H&E staining. Cigarette smoke extract combined with lipopolysaccharide (CSE+LPS)
Young Yun Jung et al.
Frontiers in pharmacology, 9, 531-531 (2018-06-15)
Because of the essential role of signal transducer and activator of transcription 3 (STAT3) in proliferation, anti-apoptosis, and chemoresistance of multiple myeloma (MM), we investigated whether icariin, a prenylated flavonol glycoside, inhibits both constitutive and inducible STAT3 activation in human
Purushottam Lamichhane et al.
Cancer research, 77(23), 6667-6678 (2017-10-11)
Ligation of programmed cell death-1 (PD-1) in the tumor microenvironment is known to inhibit effective adaptive antitumor immunity. Blockade of PD-1 in humans has resulted in impressive, durable regression responses in select tumor types. However, durable responses have been elusive
Thijs S Stutvoet et al.
The Journal of pathology, 249(1), 52-64 (2019-04-12)
Immune checkpoint inhibitors targeting programmed cell death protein 1 (PD-1) and programmed death-ligand 1 (PD-L1) have improved the survival of patients with non-small cell lung cancer (NSCLC). Still, many patients do not respond to these inhibitors. PD-L1 (CD274) expression, one
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.