콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU129811

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA6

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCCAACTGTCACACCACAACTACCACCTTATGGCGCAGAAACGCCGAGGGTGAACCCGTGTGCAATGCTTGTGGACTCTACATGAAACTCCATGGGGTGCCCAGACCACTTGCTATGAAAAAAGAGGGAATTCAAACCAGGAAACGAAAACCTAAGAACATAAATAAATCAAAGACTTGCTCTGGTAATAGCAATAATTCCATTCCCATGACTCCAACTTCCACCTCTTCTAACTCAGATGATTGCAGCAAAAATACTTCCCCCACAACACAACCTACAGCCTCAGGGGCGGGTGCCCCGGTGATGACTGGTGCGGGAGAGAGCACCAATCCCGAGAACAGCGAGCTCAAGTATTCGGGTCAAGATGGGCTCTACATAGGCGTCAGTCTCGCCTCGCCGGCCGAAGTCACGTCCTCCGTGCGACCGGATTCCTGGTGCGCCCTGGCCCTGGCCTGAGCCCACGCCGCCAGGAGGCAGGGAGGGCTCCGCCGCGGGCCTCACTCCACTCGTGTCTGCTTTTG

Ensembl | 인체 수납 번호

ENSG00000141448

NCBI 수납 번호

NM_005257

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... GATA6(2627) , GATA6(2627)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ruishuang Ma et al.
Cancer biology & therapy, 20(9), 1206-1212 (2019-05-17)
Autophagy plays a complicated role in tumorigenesis, and the effects of autophagy in drug resistance have not been fully known. The aim of this study was to evaluate autophagy activity in lung cancer cells derived from different origins and explore
Mao Guoping et al.
Oncology research, 26(7), 1023-1029 (2018-01-13)
Recent studies have suggested that the dysregulation of microRNAs (miRNAs) plays a critical role in the progression of human cancers, including gastric cancer (GC). miR-143 had been reported to function as a tumor suppressor in GC. However, the exact molecular
Chellappagounder Thangavel et al.
The American journal of pathology, 189(4), 847-867 (2019-02-02)
Caveolins (CAVs) are structural proteins of caveolae that function as signaling platforms to regulate smooth muscle contraction. Loss of CAV protein expression is associated with impaired contraction in obstruction-induced bladder smooth muscle (BSM) hypertrophy. In this study, microarray analysis of
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as
Holly Brunton et al.
Cell reports, 31(6), 107625-107625 (2020-05-14)
Pancreatic ductal adenocarcinoma (PDAC) can be divided into transcriptomic subtypes with two broad lineages referred to as classical (pancreatic) and squamous. We find that these two subtypes are driven by distinct metabolic phenotypes. Loss of genes that drive endodermal lineage

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.