콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU130711

Sigma-Aldrich

MISSION® esiRNA

targeting human FASN

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

Ensembl | 인체 수납 번호

ENSG00000169710

NCBI 수납 번호

NM_004104

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FASN(2194) , FASN(2194)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xing Zhong et al.
Oncology letters, 21(4), 245-245 (2021-03-06)
Diffuse large B-cell lymphoma (DLBCL) is the most common and heterogeneous lymphoid malignancy. The subtype with MYC and BCL-2 double-expressor lymphoma (DEL) was defined by its aggressive nature and poor survival outcome. Therefore, the development of effective therapies for the
Xiaokun Gang et al.
The Prostate, 79(8), 864-871 (2019-04-08)
Fatty acid synthase (FASN) is vital for maintaining lipid homeostasis in prostate cancer (PCa) cells, which have an increased rate of de novo fatty acid (FA) synthesis. Mutations in the gene encoding the tumor suppressor speckle-type POZ protein (SPOP), which
Valeryia Mikalayeva et al.
International journal of molecular sciences, 20(6) (2019-03-21)
Both cytosolic fatty acid synthesis (FAS) and mitochondrial fatty acid oxidation (FAO) have been shown to play a role in the survival and proliferation of cancer cells. This study aimed to confirm experimentally whether FAS and FAO coexist in breast
Débora C Bastos et al.
The Journal of pathology, 253(3), 292-303 (2020-11-10)
Loss of the tumor suppressor gene Pten in murine prostate recapitulates human carcinogenesis and causes stromal proliferation surrounding murine prostate intraepithelial neoplasia (mPIN), which is reactive to microinvasion. In turn, invasion has been shown to be regulated in part by
Gamze Ates et al.
Redox biology, 36, 101648-101648 (2020-08-31)
The oxidative degradation of lipids has been shown to be implicated in the progression of several neurodegenerative diseases and modulating lipid peroxidation may be efficacious for treating Alzheimer's disease (AD). This hypothesis is strengthened by recent findings suggesting that oxytosis/ferroptosis
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.