콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU139921

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTCACCCGGATGAAGAACATTGAGTGCATTGAGCTGGGCCGGCACCGCCTCAAGCCGTGGTACTTCTCCCCGTACCCACAGGAACTCACCACATTGCCTGTCCTCTACCTGTGCGAGTTCTGCCTCAAGTACGGCCGTAGTCTCAAGTGTCTTCAGCGTCATTTGACCAAGTGTGACCTACGACATCCTCCAGGCAATGAGATTTACCGCAAGGGCACCATCTCCTTCTTTGAGATTGATGGACGTAAGAACAAGAGTTATTCCCAGAACCTGTGTCTTTTGGCCAAGTGTTTCCTTGACCATAAGACACTGTACTATGACACAGACCCTTTCCTCTTCTACGTCATGACAGAGTATGACTGTAAGGGCTTCCACATCGTGGGCTACTTCTCCAAGGAGAAAGAATCAACGGAAGACTACAATGTGGCCTGCATCCTAAC

Ensembl | 인체 수납 번호

ENSG00000172977

NCBI 수납 번호

NM_006388

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KAT5(10524) , KAT5(10524)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xueqin Wang et al.
BMC microbiology, 10, 228-228 (2010-08-28)
Salmonella enterica is a facultative intracellular pathogen that replicates within a membrane-bound compartment termed Salmonella containing vacuole (SCV). The biogenesis of SCV requires Salmonella type III protein secretion/translocation system and their effector proteins which are translocated into host cells to
Jian Li et al.
PloS one, 6(8), e23725-e23725 (2011-08-23)
GPR50 is an orphan G-protein coupled receptor most closely related to the melatonin receptors. The physiological function of GPR50 remains unclear, although our previous studies implicate the receptor in energy homeostasis. Here, we reveal a role for GPR50 as a
Shengyuan Zeng et al.
Protein & cell, 8(3), 202-218 (2016-10-16)
UHRF2 is a ubiquitin-protein ligase E3 that regulates cell cycle, genomic stability and epigenetics. We conducted a co-immunoprecipitation assay and found that TIP60 and HDAC1 interact with UHRF2. We previously demonstrated that UHRF2 regulated H3K9ac and H3K14ac differentially in normal
Zhaoxiang Yu et al.
Archives of biochemistry and biophysics, 693, 108550-108550 (2020-08-30)
Bromodomain-containing 8 (BRD8), which belongs to the histone acetyl transferase (HAT) complex, functions as a driver in colorectal cancer. However, the role of BRD8 and its related regulatory mechanisms in hepatocellular carcinoma (HCC) remain unexplored. In this study, we found
Tara Procida et al.
International journal of molecular sciences, 22(2) (2021-01-16)
Histone variants differ in amino acid sequence, expression timing and genomic localization sites from canonical histones and convey unique functions to eukaryotic cells. Their tightly controlled spatial and temporal deposition into specific chromatin regions is accomplished by dedicated chaperone and/or
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.