콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU015461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sgpp1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TACGGGCTGATTCTCATTCCCTGCTGGAGTTCACTAGTTTGCCTAAGTAGAATCTACATGGGAATGCATTCTATCCTGGATGTCATTGCTGGATTCTTGTATACCATTTTAATCTTAATTATCTTCTACCCATTGGTGGACCTGATTGACAACTTCAACCAAACTTACAAATATGCGCCGCTCATCATCATCGGGCTTCACTTAATTTTGGGCATCTTCTCTTTCACCCTTGACACCTGGAGCACATCCCGAGGAGACACGGCTGAGATTCTGGGAAGTGGTGCTGGGATTGCATGTGGCTCACACGCTGCTTATACCCTGGGCCTATCCTTAGAACCTTCTCTGCACATGTTACCCTTAGCTATCCCCCCTCTTACTGTAACTCTGTTTGGAAAAGCCATATTACGGATCGTCCTAGGAATGCTGCTT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown
Yunsheng Yuan et al.
Applied biochemistry and biotechnology, 173(2), 421-432 (2014-03-26)
Secreted phosphoprotein 1 (SPP1) is a phosphorylated acidic glycoprotein. It is broadly expressed in a variety of tissues, and it is involved in a number of physiological and pathological events, including cancer metastasis, tissues remodeling, pro-inflammation regulation, and cell survival.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.