Skip to Content
Merck
All Photos(1)

Key Documents

EHU001471

Sigma-Aldrich

MISSION® esiRNA

targeting human AURKB

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sun Lee et al.
Pathology oncology research : POR, 26(1), 453-459 (2018-11-14)
NOP53 ribosome biogenesis factor (NOP53) is a nucleolar protein involved in oncogenesis/tumor suppression, cell cycle regulation, and cell death. Here, we investigated the role of NOP53 in the maintenance of normal nuclear shape and chromosomal stability. Depletion of NOP53 by
Xiaolei Zhang et al.
Annals of translational medicine, 8(10), 646-646 (2020-06-23)
The modification and regulation of N6-methyladenosine (m6A) at mRNA level can affect the development and progression in various tumors. ALKBH5, as an m6A demethylase, plays different roles in tumors by regulating the m6A modification of mRNA. However, its role in
Yan Guo et al.
American journal of cancer research, 10(10), 3458-3474 (2020-11-10)
Despite significant advances, skin cutaneous melanoma (SKCM) is a common life-threatening cancer worldwide. Recently, pseudogenes have been discovered to be functional in many physiological processes and the pathogenesis of various diseases, including cancer. However, their relevance to SKCM remains largely
Lin Bao et al.
Journal of Cancer, 11(7), 1712-1726 (2020-03-21)
Purpose: To investigate the potential mechanisms contributing to metastasis of clear cell renal cell carcinoma (ccRCC), screen the hub genes, associated pathways of metastatic ccRCC and identify potential biomarkers. Methods: The ccRCC metastasis gene expression profile GSE47352 was employed to
Zhibin Yu et al.
Journal of hematology & oncology, 10(1), 115-115 (2017-06-10)
SIX homeobox 3 (SIX3) is a member of the sine oculis homeobox transcription factor family. It plays a vital role in the nervous system development. Our previous study showed that the SIX3 gene is hypermethylated, and its expression is decreased

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service