Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU004551

Sigma-Aldrich

MISSION® esiRNA

targeting human STS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTCATGGCGGAAGTAATGGGATCTATAAAGGAGGAAAAGCAAACAACTGGGAAGGAGGTATCCGGGTTCCAGGCATCCTTCGTTGGCCCAGGGTGATACAGGCTGGCCAGAAGATTGATGAGCCCACTAGCAACATGGACATATTTCCTACAGTAGCCAAGCTGGCTGGAGCTCCCTTGCCTGAGGACAGGATCATTGATGGACGTGATCTGATGCCCCTGCTTGAAGGAAAAAGCCAACGCTCCGATCATGAGTTTCTCTTCCATTACTGCAACGCCTACTTAAATGCTGTGCGCTGGCACCCTCAGAACAGCACATCCATCTGGAAGGCCTTTTTCTTCACCCCCAACTTCAACCCCGTGGGTTCCAACGGATGCTTTGCCACACACGTGTGCTTCTGTTTCGGGAGTTATGTCACCCATCACGACCCACCTTTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STS(412) , STS(412)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hee-Jung Im et al.
Biomolecules & therapeutics, 20(6), 556-561 (2013-09-07)
Steroid sulfatase (STS) is responsiblefor the conversion of estrone sulfate to estrone that can stimulate growth in endocrine-dependent tumors such as prostate cancer. Although STS is considered as a therapeutic target for the estrogen-dependent diseases, cellular function of STS are
Amy M Gratton et al.
Placenta, 48, 72-79 (2016-11-23)
Preeclampsia is a serious complication of pregnancy affecting 5% of pregnancies. Our team identified 137 genes highly expressed in placenta relative to other human tissues. Here, we have explored a role for steroid sulfatase (STS) in preeclampsia by characterising STS
Cameron M Armstrong et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(22), 6064-6074 (2020-09-16)
Most patients with prostate cancer receiving enzalutamide or abiraterone develop resistance. Clinical evidence indicates that serum levels of dehydroepiandrosterone sulfate (DHEAS) and biologically active DHEA remain in the high range despite antiandrogen treatment. The conversion of DHEAS into DHEA by
Mengxi Jiang et al.
Journal of hepatology, 64(1), 44-52 (2015-07-30)
Chronic inflammatory liver diseases are associated with estrogen excess and feminization in men, which is thought to be due to compromised liver function to break down estrogens. The goal of this study is to determine whether the inflammatory induction of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service