Skip to Content
Merck
All Photos(1)

Key Documents

EHU007051

Sigma-Aldrich

MISSION® esiRNA

targeting human S100B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGACCAGGAAGGGGTGAGACAAGGAAGAGGATGTCTGAGCTGGAGAAGGCCATGGTGGCCCTCATCGACGTTTTCCACCAATATTCTGGAAGGGAGGGAGACAAGCACAAGCTGAAGAAATCCGAACTGAAGGAGCTCATCAACAATGAGCTTTCCCATTTCTTAGAGGAAATCAAAGAGCAGGAGGTTGTGGACAAAGTCATGGAAACACTGGACAATGATGGAGACGGCGAATGTGACTTCCAGGAATTCATGGCCTTTGTTGCCATGGTTACTACTGCCTGCCACGAGTTCTTTGAACATGAGTGAGATTAGAAAGCAGCCAAACCTTTCCTGTAACAGAGACGGTCATGCAAGAAAGCAGACAGCAAGGGCTTGCAGCCTAGTAGGAGCTGAGCTTTCCAGCCGTGTTGTAGCTAATTAGGAAGCTTGATTTGCTTTGTGATTGAAAAATTGAAAACCTCTTTCCAAAGGCTGTTTTAACGGCCTGCATCATTCTTTCTGCTATATTAGGCCTGTGTGTAAGCTGACTGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Teng Cao et al.
Biochimica et biophysica acta, 1863(11), 2772-2782 (2017-07-12)
S100B is a biomarker of nervous system injury, but it is unknown if it is also involved in vascular injury. In the present study, we investigated S100B function in vascular remodeling following injury. Balloon injury in rat carotid artery progressively
Giulio Morozzi et al.
Cell death and differentiation, 24(12), 2077-2088 (2017-09-09)
Muscles of sarcopenic people show hypotrophic myofibers and infiltration with adipose and, at later stages, fibrotic tissue. The origin of infiltrating adipocytes resides in fibro-adipogenic precursors and nonmyogenic mesenchymal progenitor cells, and in satellite cells, the adult stem cells of
Jin-Hua Zhang et al.
Journal of cellular biochemistry, 119(10), 8095-8111 (2018-02-01)
Ischemic stroke is the leading cause of worldwide mortality and long-term disability in adults. This study aims to explore the effects of RNA interference (RNAi)-mediated silencing of the S100B gene on nerve function recovery and morphological changes of hippocampus cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service