MilliporeSigma
All Photos(1)

Documents

EHU010441

Sigma-Aldrich

MISSION® esiRNA

targeting human VDR

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGTTCGTGTGAATGATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGGGACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGACTCGTCCAGCTTCTCCAATCTGGATCTGAGTGAAGAAGATTCAGATGACCCTTCTGTGACCCTAGAGCTGTCCCAGCTCTCCATGCTGCCCCACCTGGCTGACCTGGTCAGTTACAGCATCCAAAAGGTCATTGGCTTTGCTAAGATGATACCAGGATTCAGAGACCTCACCTCTGAGGACCAGATCGTACTGCTGAAGTCAAGTGCCATTGAGGTCATCATGTTGCGCTCCAATGAGTCCTTCACCATGGACGACATGTCCTGGACCTGTGGCAACCAAGACTACAAGTACCGCGTCAGTGACGTGACCAAAGCCGGACACAGCCTGGAGCTGATTGAGCCCCTCATCAAGTTCCAGGTGGGACTGAAGAAGCTGAACTTGCATGAGGAGGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU031901EHU023211EHU052051
vibrant-m

EHU010441

MISSION® esiRNA

vibrant-m

EHU031901

MISSION® esiRNA

vibrant-m

EHU023211

MISSION® esiRNA

vibrant-m

EHU052051

MISSION® esiRNA

Ensembl | human accession no.

ENSG00000111424

Ensembl | human accession no.

ENSG00000169575

Ensembl | human accession no.

ENSG00000173511

Ensembl | human accession no.

ENSG00000072401

esiRNA cDNA target sequence

CCAGTTCGTGTGAATGATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGGGACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGACTCGTCCAGCTTCTCCAATCTGGATCTGAGTGAAGAAGATTCAGATGACCCTTCTGTGACCCTAGAGCTGTCCCAGCTCTCCATGCTGCCCCACCTGGCTGACCTGGTCAGTTACAGCATCCAAAAGGTCATTGGCTTTGCTAAGATGATACCAGGATTCAGAGACCTCACCTCTGAGGACCAGATCGTACTGCTGAAGTCAAGTGCCATTGAGGTCATCATGTTGCGCTCCAATGAGTCCTTCACCATGGACGACATGTCCTGGACCTGTGGCAACCAAGACTACAAGTACCGCGTCAGTGACGTGACCAAAGCCGGACACAGCCTGGAGCTGATTGAGCCCCTCATCAAGTTCCAGGTGGGACTGAAGAAGCTGAACTTGCATGAGGAGGAGC

esiRNA cDNA target sequence

TCCTGCTCATGCTGTTTGTCTACTGCACAGGTTGTGGTCCTCAGCCGGTGCTGCATCAGCCGCCGGCCATGTCCTCGGCCCTTGGAACCACAATCCGCCTCACCTGCACCCTGAGGAACGACCATGACATCGGTGTGTACAGCGTCTACTGGTACCAGCAGAGGCCGGGCCACCCTCCCAGGTTCCTGCTGAGATATTTCTCACAATCAGACAAGAGCCAGGGCCCCCAGGTCCCCCCTCGCTTCTCTGGATCCAAAGATGTGGCCAGGAACAGGGGGTATTTGAGCATCTCTGAGCTGCAGCCTGAGGACGAGGCTATGTATTACTGTGCTATGGGGGCCCGCAGCTCGGAGAAGGAGGAGAGGGAGAGGGAGTGGGAGGAAGAAATGGAACCCACTGCAGCCAGGACACGTGTCCCTTGAACTGAAGACAGCAGAGGCACGCATCCCCTTGGAGAGACTGTCATGGAAGAGGGTGG

esiRNA cDNA target sequence

GGCTTAGAGCTCAACCCAGACACCTGCAGGTGCCGGAAGCTGCGAAGGTGACACATGGCTTTTCAGACTCAGCAGGGTGACTTGCCTCAGAGGCTATATCCCAGTGGGGGAACAAAGAGGAGCCTGGTAAAAAACAGCCAAGCCCCCAAGACCTCAGCCCAGGCAGAAGCTGCTCTAGGACCTGGGCCTCTCAGAGGGCTCTTCTGCCATCCCTTGTCTCCCTGAGGCCATCATCAAACAGGACAGAGTTGGAAGAGGAGACTGGGAGGCAGCAAGAGGGGTCACATACCAGCTCAGGGGAGAATGGAGTACTGTCTCAGTTTCTAACCACTCTGTGCAAGTAAGCATCTTACAACTGGCTCTTCCTCCCCTCACTAAGAAGACCCAAACCTCTGCATAATGGGATTTGGGCTTTGGTACAA

esiRNA cDNA target sequence

AGTGATCTACAGCGCGATCCACCTGCTCACTGTTCAGCTGGACCTGTGGGAGATGACTTGTTCCACTGGCAAGCCACTATTATGGGGCCTCCTGATAGCGCATATCAAGGTGGAGTCTTCTTTCTCACTGTACATTTTCCGACAGATTATCCTTTTAAACCACCAAAGATTGCTTTCACAACAAAAATTTACCATCCAAACATAAACAGTAATGGAAGTATTTGTCTCGATATTCTGAGGTCACAATGGTCACCAGCTCTGACTGTATCAAAAGTTTTATTGTCCATATGTTCTCTACTTTGTGATCCTAATCCAGATGACCCCTTAGTACCAGATATTGCACAAATCTATAAATCAGACAAAGAAAAATACAACAGACATGCAAGAGAATGGACTCAGAA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Yang Gao et al.
International journal of molecular medicine, 46(4), 1538-1550 (2020-09-19)
Psoriasis is an immune‑mediated dermatosis characterized by T‑lymphocyte‑mediated epidermal hyperplasia, for which there are currently no effective clinical treatments. 'Psoriasis 1' is a Chinese herbal medicine formulation that has been recently used extensively in China for treating patients with psoriasis. However
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with
Aurélien Mary et al.
Endocrinology, 156(6), 1965-1974 (2015-03-13)
Vascular calcification (VC) is a degenerative disease that contributes to cardiovascular morbidity and mortality. A negative relationship has been demonstrated between VC and calcium sensing receptor (CaSR) expression in the vasculature. Of interest, vitamin D response elements, which allow responsiveness
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service