Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU028861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1R

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGAATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAGAAGGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTA

Ensembl | human accession no.

ENSG00000140443

NCBI accession no.

NM_000875

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGF1R(3480) , IGF1R(3480)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yanxin Fan et al.
Molecular medicine reports, 20(1), 81-94 (2019-05-23)
It has been demonstrated that microRNAs (miRNAs) serve important roles in various biological processes, such as tumorigenesis. In the present study, the role of miR‑30a‑3p in the pathogenesis of esophageal carcinoma (EC) was investigated. Reverse transcription‑quantitative polymerase chain reaction was
Yiren Hu et al.
Pathology, research and practice, 215(12), 152674-152674 (2019-11-17)
Hepatocellular carcinoma (HCC) is among the most frequently observed forms of cancer. MicroRNAs (miRNAs) are increasingly thought to play a key role in regulating the onset and progression of a wide range of cancer types. In the present report, we
D-J Huang et al.
European review for medical and pharmacological sciences, 20(24), 5098-5106 (2017-01-05)
We investigated the interactions among the dysregulated genes in hepatocellular carcinoma (HCC) and identified the hub genes in the protein-protein interaction (PPI) network. Also, we also investigated the regulative effect of miR-379 on the IGF1/IGF1R signaling pathway and chemoresistance in
Riyo Morimoto-Kamata et al.
Cancer science, 108(8), 1574-1583 (2017-05-26)
Cathepsin G (CG), a neutrophil serine protease, induces cell migration and multicellular aggregation of human breast cancer MCF-7 cells in a process that is dependent on E-cadherin and CG enzymatic activity. While these tumor cell aggregates can cause tumor emboli
Yann Neuzillet et al.
BMC cancer, 17(1), 636-636 (2017-09-09)
The insulin growth factor (IGF) pathway has been proposed as a potential therapeutic target in bladder cancer. We characterized the expression of components of the IGF pathway - insulin growth factor receptors (INSR, IGF1R, IGF2R), ligands (INS, IGF1, IGF2), and
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service