Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU037471

Sigma-Aldrich

MISSION® esiRNA

targeting human ECT2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGGATTCTCCGGAATTTGAAAATGTATTTGTAGTCACGGACTTTCAGGATTCTGTCTTTAATGACCTCTACAAGGCTGATTGTAGAGTTATTGGACCACCAGTTGTATTAAATTGTTCACAAAAAGGAGAGCCTTTGCCATTTTCATGTCGCCCGTTGTATTGTACAAGTATGATGAATCTAGTACTATGCTTTACTGGATTTAGGAAAAAAGAAGAACTAGTCAGGTTGGTGACATTGGTCCATCACATGGGTGGAGTTATTCGAAAAGACTTTAATTCAAAAGTTACACATTTGGTGGCAAATTGTACACAAGGAGAAAAATTCAGGGTTGCTGTGAGTCTAGGTACTCCAATTATGAAGCCAGAATGGATTTATAAAGCTTGGGAAAGGCGGAATGAACAGGAT

Ensembl | human accession no.

ENSG00000114346

NCBI accession no.

NM_018098

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ECT2(1894) , ECT2(1894)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
Zeinab Kosibaty et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 551-567 (2018-12-14)
Epithelial cell transforming sequence 2 (ECT2), a guanine nucleotide exchange factor, is predominantly localized in the nucleus of non-transformed cells and functions to regulate cytokinesis. ECT2 is also localized in the cytoplasm of cancer cells. Aberrant cytoplasmic expression of ECT2
J Sebastián Gómez-Cavazos et al.
Current biology : CB, 30(16), 3101-3115 (2020-07-04)
Cytokinesis partitions the cell contents to complete mitosis. During cytokinesis, polo-like kinase 1 (PLK1) activates the small GTPase RhoA to assemble a contractile actomyosin ring. PLK1 is proposed to pattern RhoA activation by creating a docking site on the central
Qi Zhang et al.
Theranostics, 10(23), 10769-10790 (2020-09-16)
Rationale: A number of guanine nucleotide exchange factors (GEFs) including epithelial cell transforming factor ECT2 are believed to drive carcinogenesis through activating distinct oncogenic GTPases. Yet, whether GEF-independent activity of ECT2 also plays a role in tumorigenesis remains unclear. Methods:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service