Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU039821

Sigma-Aldrich

MISSION® esiRNA

targeting human LGR5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACTCCCTGGGAAAGAAATGCTTTGATGGGCTCCACAGCCTAGAGACTTTAGATTTAAATTACAATAACCTTGATGAATTCCCCACTGCAATTAGGACACTCTCCAACCTTAAAGAACTAGGATTTCATAGCAACAATATCAGGTCGATACCTGAGAAAGCATTTGTAGGCAACCCTTCTCTTATTACAATACATTTCTATGACAATCCCATCCAGTTTGTTGGGAGATCTGCTTTTCAACATTTACCTGAACTAAGAACACTGACTCTGAATGGTGCCTCACAAATAACTGAATTTCCTGATTTAACTGGAACTGCAAACCTGGAGAGTCTGACTTTAACTGGAGCACAGATCTCATCTCTTCCTCAAACCGTCTGCAATCAGTTACCTAATCTCCAAGTGCTAGATCTGTCTTACAACCTATTAGAAGATTTACCCAGTTTTTCAGTCTGCCAAAAGCTTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Gun Jang et al.
The American journal of pathology, 188(10), 2236-2250 (2018-07-24)
We investigated the expression profile of leucine-rich, repeat-containing, G-protein-coupled receptor 5 (LGR5) during colorectal cancer (CRC) progression and determined the prognostic impact of LGR5 in a large cohort of CRC samples. LGR5 expression was higher in CRCs than in normal
Xiangfei Wang et al.
Oncogenesis, 7(8), 57-57 (2018-08-10)
LGR5 plays a critical role in tissue development and the maintenance of adult stem cells in gastrointestinal tract. However, the oncogenic role of LGR5 in the development of gastric adenocarcinoma remains elusive. Here, we show that LGR5 promotes gastric adenocarcinoma
Lalarukh Haris Shaikh et al.
The Journal of clinical endocrinology and metabolism, 100(6), E836-E844 (2015-04-29)
Aldosterone synthesis and cellularity in the human adrenal zona glomerulosa (ZG) is sparse and patchy, presumably due to salt excess. The frequency of somatic mutations causing aldosterone-producing adenomas (APAs) may be a consequence of protection from cell loss by constitutive
Johannes Gojo et al.
Cancer cell, 38(1), 44-59 (2020-07-15)
Ependymoma is a heterogeneous entity of central nervous system tumors with well-established molecular groups. Here, we apply single-cell RNA sequencing to analyze ependymomas across molecular groups and anatomic locations to investigate their intratumoral heterogeneity and developmental origins. Ependymomas are composed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service